Difference between revisions of "LncRNAWiki:Participants"

From LncRNAWiki
Jump to: navigation, search
(Created page with "{{basic| tID = ENSTR0000420411.1| same = | location = chrY+:1470936-1484314| classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)| sequence = <dnaseq>CC...")
(lncRNAWiki Team (lncwiki@big.ac.cn))
 
(14 intermediate revisions by 3 users not shown)
Line 1: Line 1:
{{basic|
+
==lncRNAWiki Team (lncwiki@big.ac.cn)==
tID = ENSTR0000420411.1|
+
* Zhang Zhang: Beijing Institute of Genomics, Chinese Academy of Sciences (PI)
same = |
+
 
location = chrY+:1470936-1484314|
+
* Lina Ma: Beijing Institute of Genomics, Chinese Academy of Sciences
classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)|
+
 
sequence =
+
* Chunlei Yu: Beijing Institute of Genomics, Chinese Academy of Sciences; University of Chinese Academy of Sciences
<dnaseq>CCCAGAGAACTGCCACTCCATAGCCTGTGGGCATCCAGGGGTGAGCGGCAGCGATGGCGCCCCATGGAGGAAACACACTGGAAATCGTGCAGAAGATGGGAAGATGCAGGCTGGAGTGCGGAGAAGGACTGAGACCCTGCCTGGTAGACGGCACCGTCACAGCAGCCGTCTGCCTGCTAGGAGGAGCGTCTCCACCAGCAGCAGGCCGGCCCCTGAGGGAGACAGCAGAGAGCTGGAGTCCTGGCCAGCCAGGCGGGGATCCTTCAGCAGGACACAGGGGACACAGCAGGCAACAGGAGCTCAGAACGCTCTCGGCGACCCTGCTGAGTAACTTGTGGACTTTGTCGTCTGGCCAGTCATGCAGGATCCGGCACAGGACGTACAGCTCAGCGCTGGGGAGGGGGTCCCTGAAAAAGTCACCTGGTTTAAAGACAAAACGAGATACGTCCGTCAGGTATGGAAGAAGCAGTCCTCCCCGGACAGATCCTGGGACGGCCACCCGCATCCTAAATCAGGGACAGAGAAGAGAGGGGTGTGGGCGGGAATGGGTCTTCCTGAAGTACATCCCCGTGGGGACTTGAACAGAGCTCCATGAGGAGCTGGTTAGTGATGTCACGCCCGTGCGGTTTGACTCGGGCTGAGAAAACGCTGGGGACAGTGGCTCACACCTGTAATCTCAGCATTTTGGGAGCCTGAGCCTCCCAGAGGGCTGGGATTCCAGGCGTCTCCTGTCAATCCGTCCTGGCCTCAGCAGCTGCCACCTGGAAGTTCTCCTTCAAGTCTAACCTAAGGCCACACTGTGACGGCTCTCGGGTCAGTTCCTTCCGTGACCTCGGCACCGTGGATGCCCATGAATGCTGATCTCGGCTGTTCCCCATCTCCACTCCCCTCACGTCTCGGCTACTTGCACTGATGATAACTTCA</dnaseq>|
+
 
}}
+
* Ang Li: Beijing Institute of Genomics, Chinese Academy of Sciences
 +
 
 +
* Dong Zou: Beijing Institute of Genomics, Chinese Academy of Sciences
 +
 
 +
* Xingjian Xu: Beijing Institute of Genomics, Chinese Academy of Sciences; University of Chinese Academy of Sciences
 +
 
 +
* Lin Xia: Beijing Institute of Genomics, Chinese Academy of Sciences; University of Chinese Academy of Sciences
 +
 
 +
* Jun Yu: Beijing Institute of Genomics, Chinese Academy of Sciences
 +
 
 +
* Vladimir B. Bajic:King Abdullah University of Science and Technology (KAUST)

Latest revision as of 05:51, 2 April 2015

lncRNAWiki Team (lncwiki@big.ac.cn)

  • Zhang Zhang: Beijing Institute of Genomics, Chinese Academy of Sciences (PI)
  • Lina Ma: Beijing Institute of Genomics, Chinese Academy of Sciences
  • Chunlei Yu: Beijing Institute of Genomics, Chinese Academy of Sciences; University of Chinese Academy of Sciences
  • Ang Li: Beijing Institute of Genomics, Chinese Academy of Sciences
  • Dong Zou: Beijing Institute of Genomics, Chinese Academy of Sciences
  • Xingjian Xu: Beijing Institute of Genomics, Chinese Academy of Sciences; University of Chinese Academy of Sciences
  • Lin Xia: Beijing Institute of Genomics, Chinese Academy of Sciences; University of Chinese Academy of Sciences
  • Jun Yu: Beijing Institute of Genomics, Chinese Academy of Sciences
  • Vladimir B. Bajic:King Abdullah University of Science and Technology (KAUST)

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[Xetvf7upHOv2Jct9mo3srgAAAAM] 2019-12-07 09:23:13: Fatal exception of type "TypeError"

Navigation menu