Difference between revisions of "LncRNAWiki:How to contribute"

From LncRNAWiki
Jump to: navigation, search
(Created page with "You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA. * If you are a researcher, please share your knowledge and curate genes...")
 
(2 intermediate revisions by one other user not shown)
Line 1: Line 1:
{{basic|
+
You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.
tID = ENST00000455607.2|
+
* If you are a researcher, please share your knowledge and curate genes in your area of expertise.
location = chr6-:150117711-150119308|
+
* If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.  
same = |
+
* If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
classification = antisense(be contained in the intron of NM_005389:chr6+,150117636-150123335)|
+
* If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
sequence = <dnaseq>TTTTGAGACAGGGTCTCACTTTGTCACCCAGGCTGGAATGCAGTAGTACAAGCATGGCTCACTGCAGCCTCAACCTGTCAGGCTCACGCAATCCAAGCTATCCTCCCACCTCAGCCTCTTGAGTAGCTGGGACTACAAGTGCCTGCCACATCTAATTTTTTGTATTTTTTGTAGAGATGGAGTTTTGCCATGTTGCCCAGGCTGGTCTCGAACTTCTGAGCGCAAGTGATTCATCTGCCTTAGCCTCCCAAAGTGCTGGGGTTACATGCATGAGCCACCATGCCCGGCCATATATCCTACTATTCTTTAAGATTCAGTTCAAGTTCCATCCGTGTGTGATGTCTCCTTGACCACTCACTGCACAATTCTCTCCCTCATATGCATATTTTATTTTCCTTCCAATAGATATCCTGTGTTAATTATATGTTATCATATCGCTAATTTCCCAGTTACATATATGACATATCTCTTCTAGAATACAAGCTTTGTGAGAATATAATGTATGGCAAATACTTTCTCATATCTCCCATACACCAAATACAGCCTTACATATTCTGCTATTTAAAAAACATCAAACTGGCCGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTCGGAGGCTGAGGCGGGCAGATCACCCGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCTGGGCGTGGTGGCGGGCGCCTGTTATCCCAGCTACTCGGGAGGCTAAGGCAGGAGAATCACTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCTGAAATTGGGCCACTGCACTCCAGCCTGGGTGACAAGAGCAAAACTCCACCTCAAAAACAAAAAACAAAAAACAAAAAACAAACAAACAAAAAAAACCTGATTATCAGGTCATAAACTCCAGAGGGATTTTCCCAATTCTACTGTTGTCCTAGTTCTTACCTGGATCAAATATGAGCGCCACAAACTGGGGTTTAGTAATTTTCATGTCATTTATACAATTGTTTGCATATGAAAAAAGAAAAGAGTAACAGCTAAATGTAACCAAAATGTATGATATAAAAGTCTAATTATATTTTGAACATCATCTA</dnaseq>|
+
* At the very least, please spread this news to any one who might be of interest.
}}
 
[[Category:Antisense(intronic)]]
 
 
 
{{annotation|
 
tID = ENST00000455607.2|
 
ann = <tab class=wikitable sep=tab head=top>
 
Source Type Begin End ID Classfication
 
HAVANA gene 150117711 150119308 ENSG00000231760.2 antisense
 
HAVANA transcript 150117711 150119308 ENST00000455607.2 antisense
 
HAVANA exon 150119057 150119308 NA NA
 
HAVANA exon 150117711 150118575 NA NA
 
</tab>|
 
}}
 
 
 
{{annotation|
 
tID = ENST00000455607.2|
 
ann = <tab class=wikitable sep=tab head=top>
 
Source Type Begin End ID Classfication
 
HAVANA gene 150117711 150119308 ENSG00000231760.2 antisense
 
HAVANA transcript 150117711 150119308 ENST00000455607.2 antisense
 
HAVANA exon 150119057 150119308 NA NA
 
HAVANA exon 150117711 150118575 NA NA
 
</tab>|
 
}}
 

Latest revision as of 14:41, 16 June 2014

You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.

  • If you are a researcher, please share your knowledge and curate genes in your area of expertise.
  • If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
  • If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
  • If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
  • At the very least, please spread this news to any one who might be of interest.

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[XfU3uTbRQp8yTc6zBmWSxAAAAAM] 2019-12-14 19:27:56: Fatal exception of type "TypeError"

Navigation menu