Difference between revisions of "LncRNAWiki:FAQ"

From LncRNAWiki
Jump to: navigation, search
(Created page with "{{basic| tID = ENSTR0000509780.1| same = | location = chrY+:1696639-1705356| classification = sense(by contained by NM_001171038:chrY+,1683940-1711974)| sequence = <dnaseq>GAA...")
Line 5: Line 5:
 
classification = sense(by contained by NM_001171038:chrY+,1683940-1711974)|
 
classification = sense(by contained by NM_001171038:chrY+,1683940-1711974)|
 
sequence = <dnaseq>GAAGAGCTTTTTACGGCCATCTACAGGTAACACCCATCACTTTGAAACCAACAACTCAGATAAGATTCTGTTTATTTTTAAAGGACTTAGGAAACCCAATCCATTTACTCAAATGGCACAACCCAGGAGGAAGCTGCCATTTAATTTAAAATAACATCCCCTATCCCCACTACTACCCCAGATTTTGCTCATCTGATGTTTAAATTGATCAAATTCCTGAGGAGGTGCAACGTGACCCTTCCTTCGAAAGGACTACTCACAAACTCAGTGTTTATGTAGAAAATGGAGCCACCGCGCCCGACCTCAGTATTTTCTTATCTTTCTCCTAAGCCTTTTTGTTTTCTGAGGCTAGGTCTGCAGGTGACTAGCCTGGAAGACCTGGGAAAGGCGTGACCCATCCAGGTGACCTTTTGTGCCCAGAATAGGTTTAGTCAAATGGGATTGGATTGCAGGCTGACCTCGGTGTGCCTGCCCTGTGTTCCAGGGGATTTCTTCAAAGACCCTCTTCCG</dnaseq>|
 
sequence = <dnaseq>GAAGAGCTTTTTACGGCCATCTACAGGTAACACCCATCACTTTGAAACCAACAACTCAGATAAGATTCTGTTTATTTTTAAAGGACTTAGGAAACCCAATCCATTTACTCAAATGGCACAACCCAGGAGGAAGCTGCCATTTAATTTAAAATAACATCCCCTATCCCCACTACTACCCCAGATTTTGCTCATCTGATGTTTAAATTGATCAAATTCCTGAGGAGGTGCAACGTGACCCTTCCTTCGAAAGGACTACTCACAAACTCAGTGTTTATGTAGAAAATGGAGCCACCGCGCCCGACCTCAGTATTTTCTTATCTTTCTCCTAAGCCTTTTTGTTTTCTGAGGCTAGGTCTGCAGGTGACTAGCCTGGAAGACCTGGGAAAGGCGTGACCCATCCAGGTGACCTTTTGTGCCCAGAATAGGTTTAGTCAAATGGGATTGGATTGCAGGCTGACCTCGGTGTGCCTGCCCTGTGTTCCAGGGGATTTCTTCAAAGACCCTCTTCCG</dnaseq>|
 +
}}
 +
 +
{{annotation|
 +
tID = ENSTR0000509780.1|
 +
ann = <tab class=wikitable sep=tab head=top>
 +
Source Type Begin End ID Classfication
 +
HAVANA gene 1696639 1705356 ENSGR0000249358.1 processed_transcript
 +
HAVANA transcript 1696639 1705356 ENSTR0000509780.1 processed_transcript
 +
HAVANA exon 1696639 1696926 NA NA
 +
HAVANA exon 1705135 1705356 NA NA
 +
</tab>|
 
}}
 
}}

Revision as of 08:46, 19 November 2013

Basic Information

Transcript ID

ENSTR0000509780.1

Source

{{{source}}}

Same with

'

Classification

sense(by contained by NM_001171038:chrY+,1683940-1711974)

Length

{{{length}}}

Genomic location

chrY+:1696639-1705356

Exon number

{{{number}}}

Exons

{{{exons}}}

Genome context

{{{context}}}

Sequence
000001 GAAGAGCTTT TTACGGCCAT CTACAGGTAA CACCCATCAC TTTGAAACCA ACAACTCAGA TAAGATTCTG TTTATTTTTA 000080
000081 AAGGACTTAG GAAACCCAAT CCATTTACTC AAATGGCACA ACCCAGGAGG AAGCTGCCAT TTAATTTAAA ATAACATCCC 000160
000161 CTATCCCCAC TACTACCCCA GATTTTGCTC ATCTGATGTT TAAATTGATC AAATTCCTGA GGAGGTGCAA CGTGACCCTT 000240
000241 CCTTCGAAAG GACTACTCAC AAACTCAGTG TTTATGTAGA AAATGGAGCC ACCGCGCCCG ACCTCAGTAT TTTCTTATCT 000320
000321 TTCTCCTAAG CCTTTTTGTT TTCTGAGGCT AGGTCTGCAG GTGACTAGCC TGGAAGACCT GGGAAAGGCG TGACCCATCC 000400
000401 AGGTGACCTT TTGTGCCCAG AATAGGTTTA GTCAAATGGG ATTGGATTGC AGGCTGACCT CGGTGTGCCT GCCCTGTGTT 000480
000481 CCAGGGGATT TCTTCAAAGA CCCTCTTCCG
[back to top]

Template:Annotation

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[XemEvfqFBZ6m3Zh7o9XpqgAAAAM] 2019-12-05 22:29:19: Fatal exception of type "TypeError"

Navigation menu