Difference between revisions of "LncRNAWiki:Contact"

From LncRNAWiki
Jump to: navigation, search
(Created page with "lncRNAWiki is developed and maintained by [http://cbb.big.ac.cn the Zhang Lab] at [http://english.big.cas.cn Beijing Institute of Genomics, Chinese Academy of Sciences]. ; Po...")
 
Line 1: Line 1:
{{basic|
+
lncRNAWiki is developed and maintained by [http://cbb.big.ac.cn the Zhang Lab] at [http://english.big.cas.cn Beijing Institute of Genomics, Chinese Academy of Sciences].
tID = ENSTR0000425740.2|
 
same = |
 
location = chrY+:1470704-1482808|
 
classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)|
 
sequence = <dnaseq>CACAGGCCGGGAACAGCAGCTGGGAGCGGAGCACGGGGGAAACGTGGATGCGCTGAGCTCCCTACAACCGCAGTGAGCATGTGCCCAGGAGGGCCTCACGGGGTGGGTGTGAGTCTGGCCTGCCTGGGCTCGGGGTGGGGGGTGTTTACAGACGCATTTCAGCCCCGCAGCAGGGGCTGGGGAGGTCCCGCTCGTGACAGTCTCTGCACCAAGGCAGGAGAGATGGAAGCCGCCCAGAGAACTGCCACTCCATAGCCTGTGGGCATCCAGGGGTGAGCGGCAGCGATGGCGCCCCATGGAGGAAACACACTGGAAATCGTGCAGAAGATGGGAAGATGCAGGCTGGAGTGCGGAGAAGGACTGAGACCCTGCCTGGTAGACGGCACCGTCACAGCAGCCGTCTGCCTGCTAGGAGGAGCGTCTCCACCAGCAGCAGGCCGGCCCCTGAGGGAGACAGCAGAGAGCTGGAGTCCTGGCCAGCCAGGCGGGGATCCTTCAGCAGGACACAGGGGACACAGCAGGCAACAGGAGCTCAGAACGCTCTCGGCGACCCTGCTGAGTAACTTGTGGACTTTGTCGTCTGGCCAGTCATGCAGGATCCGGCACAGGACGTACAGCTCAGCGCTGGGGAGGGGGTCCCTGAAAAAGTCACCTGGTTTAAAGACAAAACGAGATACGTCCGTCAGAGACAGAAGAGGAGACAGACACAGAGGAGAAGGCCACGTGGAGACGGAGGCAGAGACTGGAGTGATGCGGCCACAAGCCCAGGGACGCCTGGAGCCCCCAGGAGCTGGAAGAGGCGGGAAGGATCCTCCCCTAGAGCCTCTCAGAAAGAATCAA</dnaseq>|
 
}}
 
  
{{annotation|
+
; Postal Address:
tID = ENSTR0000425740.2|
+
: Dr. Zhang Zhang, PI
ann = <tab class=wikitable sep=tab head=top>
+
: Beijing Institute of Genomics
Source Type Begin End ID Classfication
+
: Chinese Academy of Sciences
HAVANA gene 1470662 1484319 ENSGR0000236017.2 antisense
+
: No.1 Beichen West Road
HAVANA transcript 1470704 1482808 ENSTR0000425740.2 antisense
+
: Chaoyang District, Beijing 100101
HAVANA exon 1470704 1471118 NA NA
+
: China
HAVANA exon 1472354 1472478 NA NA
+
 
HAVANA exon 1481636 1481781 NA NA
+
; Email: zhangzhang (AT) big.ac.cn
HAVANA exon 1482655 1482808 NA NA
+
; Telephone: 86-10-84097845
</tab>|
+
; Fax: 86-10-84097298
}}
+
; Map
 +
<htmlet nocache="yes">cbb</htmlet>

Latest revision as of 09:51, 3 June 2014

lncRNAWiki is developed and maintained by the Zhang Lab at Beijing Institute of Genomics, Chinese Academy of Sciences.

Postal Address
Dr. Zhang Zhang, PI
Beijing Institute of Genomics
Chinese Academy of Sciences
No.1 Beichen West Road
Chaoyang District, Beijing 100101
China
Email
zhangzhang (AT) big.ac.cn
Telephone
86-10-84097845
Fax
86-10-84097298
Map


View Larger Map

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[Xe1OnDOkl54b2I1hFkn@1QAAAAo] 2019-12-08 19:27:27: Fatal exception of type "TypeError"

Navigation menu