Difference between revisions of "LncRNAWiki:Contact"

From LncRNAWiki
Jump to: navigation, search
(Created page with "{{basic| tID = ENSTR0000425740.2| same = | location = chrY+:1470704-1482808| classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)| sequence = <dnaseq>CA...")
(Created page with "lncRNAWiki is developed and maintained by [http://cbb.big.ac.cn the Zhang Lab] at [http://english.big.cas.cn Beijing Institute of Genomics, Chinese Academy of Sciences]. ; Po...")
 
(8 intermediate revisions by one other user not shown)
Line 1: Line 1:
{{basic|
+
lncRNAWiki is developed and maintained by [http://cbb.big.ac.cn the Zhang Lab] at [http://english.big.cas.cn Beijing Institute of Genomics, Chinese Academy of Sciences].
tID = ENSTR0000425740.2|
+
 
same = |
+
; Postal Address:
location = chrY+:1470704-1482808|
+
: Dr. Zhang Zhang, PI
classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)|
+
: Beijing Institute of Genomics
sequence =
+
: Chinese Academy of Sciences
<dnaseq>CACAGGCCGGGAACAGCAGCTGGGAGCGGAGCACGGGGGAAACGTGGATGCGCTGAGCTCCCTACAACCGCAGTGAGCATGTGCCCAGGAGGGCCTCACGGGGTGGGTGTGAGTCTGGCCTGCCTGGGCTCGGGGTGGGGGGTGTTTACAGACGCATTTCAGCCCCGCAGCAGGGGCTGGGGAGGTCCCGCTCGTGACAGTCTCTGCACCAAGGCAGGAGAGATGGAAGCCGCCCAGAGAACTGCCACTCCATAGCCTGTGGGCATCCAGGGGTGAGCGGCAGCGATGGCGCCCCATGGAGGAAACACACTGGAAATCGTGCAGAAGATGGGAAGATGCAGGCTGGAGTGCGGAGAAGGACTGAGACCCTGCCTGGTAGACGGCACCGTCACAGCAGCCGTCTGCCTGCTAGGAGGAGCGTCTCCACCAGCAGCAGGCCGGCCCCTGAGGGAGACAGCAGAGAGCTGGAGTCCTGGCCAGCCAGGCGGGGATCCTTCAGCAGGACACAGGGGACACAGCAGGCAACAGGAGCTCAGAACGCTCTCGGCGACCCTGCTGAGTAACTTGTGGACTTTGTCGTCTGGCCAGTCATGCAGGATCCGGCACAGGACGTACAGCTCAGCGCTGGGGAGGGGGTCCCTGAAAAAGTCACCTGGTTTAAAGACAAAACGAGATACGTCCGTCAGAGACAGAAGAGGAGACAGACACAGAGGAGAAGGCCACGTGGAGACGGAGGCAGAGACTGGAGTGATGCGGCCACAAGCCCAGGGACGCCTGGAGCCCCCAGGAGCTGGAAGAGGCGGGAAGGATCCTCCCCTAGAGCCTCTCAGAAAGAATCAA</dnaseq>|
+
: No.1 Beichen West Road
}}
+
: Chaoyang District, Beijing 100101
 +
: China
 +
 
 +
; Email: zhangzhang (AT) big.ac.cn
 +
; Telephone: 86-10-84097845
 +
; Fax: 86-10-84097298
 +
; Map
 +
<htmlet nocache="yes">cbb</htmlet>

Latest revision as of 09:51, 3 June 2014

lncRNAWiki is developed and maintained by the Zhang Lab at Beijing Institute of Genomics, Chinese Academy of Sciences.

Postal Address
Dr. Zhang Zhang, PI
Beijing Institute of Genomics
Chinese Academy of Sciences
No.1 Beichen West Road
Chaoyang District, Beijing 100101
China
Email
zhangzhang (AT) big.ac.cn
Telephone
86-10-84097845
Fax
86-10-84097298
Map


View Larger Map

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[XfH-iIDodO-ngvCzxGoYkgAAAAg] 2019-12-12 08:51:23: Fatal exception of type "TypeError"

Navigation menu