Difference between revisions of "LncRNAWiki:Acknowledgements"

From LncRNAWiki
Jump to: navigation, search
(Created page with "{{basic| tID = ENSTR0000443929.1| same = | location = chrY+:1470662-1472386| classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)| sequence = <dnaseq>TG...")
 
(3 intermediate revisions by 2 users not shown)
Line 1: Line 1:
{{basic|
+
This work was supported by grants from National Natural Science Foundation of China (Grant No. 31200978 to Lina Ma), the “100-Talent Program” of Chinese Academy of Sciences (Y1SLXb1365), the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB13040500), and National Programs for High Technology Research and Development (863 Program; 2012AA020409), the Ministry of Science and Technology of the People’s Republic of China.
tID = ENSTR0000443929.1|
 
same = |
 
location = chrY+:1470662-1472386|
 
classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)|
 
sequence = <dnaseq>TGTGTGGGCACCAGAGGGTGAACTGAGGTCTGAGGGTCGGGACACAGGCCGGGAACAGCAGCTGGGAGCGGAGCACGGGGGAAACGTGGATGCGCTGAGCTCCCTACAACCGCAGTGAGCATGTGCCCAGGAGGGCCTCACGGGGTGGGTGTGAGTCTGGCCTGCCTGGGCTCGGGGTGGGGGGTGTTTACAGACGCATTTCAGCCCCGCAGCAGGGGCTGGGGAGGTCCCGCTCGTGACAGTCTCTGCACCAAGGCAGGAGAGATGGAAGCCGCCCAGAGAACTGCCACTCCATAGCCTGTGGGCATCCAGGGGTGAGCGGCAGCGATGGCGCCCCATGGAGGAAACACACTGGAAATCGTGCAGAAGATGGGAAGATGCAGGCTGGAGTGCGGAGAAGGACTGAGACCCTGCCTGGTAGACGGCACCGTCACAGCAGCCGTCTGCCTGCTAGGAGGCTCCGCTCCTTGCCTTCAGTCTGCACCAGCATGTTCAGTGACTGCATCAGGGCGCGCTGCGCCACCCTCTTCTCCTCATCCAGGAGCGTCTCCACCAGCAGCAGGCCGGCCCCTGA</dnaseq>|
 
}}
 

Latest revision as of 12:58, 3 October 2014

This work was supported by grants from National Natural Science Foundation of China (Grant No. 31200978 to Lina Ma), the “100-Talent Program” of Chinese Academy of Sciences (Y1SLXb1365), the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB13040500), and National Programs for High Technology Research and Development (863 Program; 2012AA020409), the Ministry of Science and Technology of the People’s Republic of China.

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[XfUufEk-tQ8QkQ252x5vKgAAAAk] 2019-12-14 18:48:30: Fatal exception of type "TypeError"

Navigation menu