Difference between revisions of "LncRNAWiki:Acknowledgements"

From LncRNAWiki
Jump to: navigation, search
(Created page with "{{basic| tID = ENSTR0000443929.1| same = | location = chrY+:1470662-1472386| classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)| sequence = <dnaseq>TG...")
Line 5: Line 5:
 
classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)|
 
classification = antisense(overlap with NM_001173474:chrY-,1472031-1521870)|
 
sequence = <dnaseq>TGTGTGGGCACCAGAGGGTGAACTGAGGTCTGAGGGTCGGGACACAGGCCGGGAACAGCAGCTGGGAGCGGAGCACGGGGGAAACGTGGATGCGCTGAGCTCCCTACAACCGCAGTGAGCATGTGCCCAGGAGGGCCTCACGGGGTGGGTGTGAGTCTGGCCTGCCTGGGCTCGGGGTGGGGGGTGTTTACAGACGCATTTCAGCCCCGCAGCAGGGGCTGGGGAGGTCCCGCTCGTGACAGTCTCTGCACCAAGGCAGGAGAGATGGAAGCCGCCCAGAGAACTGCCACTCCATAGCCTGTGGGCATCCAGGGGTGAGCGGCAGCGATGGCGCCCCATGGAGGAAACACACTGGAAATCGTGCAGAAGATGGGAAGATGCAGGCTGGAGTGCGGAGAAGGACTGAGACCCTGCCTGGTAGACGGCACCGTCACAGCAGCCGTCTGCCTGCTAGGAGGCTCCGCTCCTTGCCTTCAGTCTGCACCAGCATGTTCAGTGACTGCATCAGGGCGCGCTGCGCCACCCTCTTCTCCTCATCCAGGAGCGTCTCCACCAGCAGCAGGCCGGCCCCTGA</dnaseq>|
 
sequence = <dnaseq>TGTGTGGGCACCAGAGGGTGAACTGAGGTCTGAGGGTCGGGACACAGGCCGGGAACAGCAGCTGGGAGCGGAGCACGGGGGAAACGTGGATGCGCTGAGCTCCCTACAACCGCAGTGAGCATGTGCCCAGGAGGGCCTCACGGGGTGGGTGTGAGTCTGGCCTGCCTGGGCTCGGGGTGGGGGGTGTTTACAGACGCATTTCAGCCCCGCAGCAGGGGCTGGGGAGGTCCCGCTCGTGACAGTCTCTGCACCAAGGCAGGAGAGATGGAAGCCGCCCAGAGAACTGCCACTCCATAGCCTGTGGGCATCCAGGGGTGAGCGGCAGCGATGGCGCCCCATGGAGGAAACACACTGGAAATCGTGCAGAAGATGGGAAGATGCAGGCTGGAGTGCGGAGAAGGACTGAGACCCTGCCTGGTAGACGGCACCGTCACAGCAGCCGTCTGCCTGCTAGGAGGCTCCGCTCCTTGCCTTCAGTCTGCACCAGCATGTTCAGTGACTGCATCAGGGCGCGCTGCGCCACCCTCTTCTCCTCATCCAGGAGCGTCTCCACCAGCAGCAGGCCGGCCCCTGA</dnaseq>|
 +
}}
 +
 +
{{annotation|
 +
tID = ENSTR0000443929.1|
 +
ann = <tab class=wikitable sep=tab head=top>
 +
Source Type Begin End ID Classfication
 +
HAVANA gene 1470662 1484319 ENSGR0000236017.2 antisense
 +
HAVANA transcript 1470662 1472386 ENSTR0000443929.1 antisense
 +
HAVANA exon 1470662 1471118 NA NA
 +
HAVANA exon 1472270 1472386 NA NA
 +
</tab>|
 
}}
 
}}

Revision as of 09:15, 19 November 2013

Basic Information

Transcript ID

ENSTR0000443929.1

Source

{{{source}}}

Same with

'

Classification

antisense(overlap with NM_001173474:chrY-,1472031-1521870)

Length

{{{length}}}

Genomic location

chrY+:1470662-1472386

Exon number

{{{number}}}

Exons

{{{exons}}}

Genome context

{{{context}}}

Sequence
000001 TGTGTGGGCA CCAGAGGGTG AACTGAGGTC TGAGGGTCGG GACACAGGCC GGGAACAGCA GCTGGGAGCG GAGCACGGGG 000080
000081 GAAACGTGGA TGCGCTGAGC TCCCTACAAC CGCAGTGAGC ATGTGCCCAG GAGGGCCTCA CGGGGTGGGT GTGAGTCTGG 000160
000161 CCTGCCTGGG CTCGGGGTGG GGGGTGTTTA CAGACGCATT TCAGCCCCGC AGCAGGGGCT GGGGAGGTCC CGCTCGTGAC 000240
000241 AGTCTCTGCA CCAAGGCAGG AGAGATGGAA GCCGCCCAGA GAACTGCCAC TCCATAGCCT GTGGGCATCC AGGGGTGAGC 000320
000321 GGCAGCGATG GCGCCCCATG GAGGAAACAC ACTGGAAATC GTGCAGAAGA TGGGAAGATG CAGGCTGGAG TGCGGAGAAG 000400
000401 GACTGAGACC CTGCCTGGTA GACGGCACCG TCACAGCAGC CGTCTGCCTG CTAGGAGGCT CCGCTCCTTG CCTTCAGTCT 000480
000481 GCACCAGCAT GTTCAGTGAC TGCATCAGGG CGCGCTGCGC CACCCTCTTC TCCTCATCCA GGAGCGTCTC CACCAGCAGC 000560
000561 AGGCCGGCCC CTGA
[back to top]

Template:Annotation

Navigation menu

Internal error - LncRNAWiki

Internal error

Jump to: navigation, search
[XetxqtY@@GE4PWR7Xl4NFwAAAAI] 2019-12-07 09:32:28: Fatal exception of type "TypeError"

Navigation menu