Difference between revisions of "Lnc-ZRANB1-2:1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>GATCCACTAGCCCAGGGCTTCTCAAGCTGGAATGTGGACATGAATCACCATGGATCTGGTTACGTTGCAGATTCTGACTCAGCAGGTCTGAGGCGGGGCCTGACATTCTGCACGGCTGGCCTGCTCCGGGCGCTGCTGATGCTGCTGGTTCCTGGACCACCCTTGAGACCCTGGATGACCTCTGAGGTGCTGCCTCCTTGCAAAAACCCTCAGCTCTTGGGACCTCTCCCTGCGCTTCCGAAGCCCTTTCAGATATTTTCCTGTAGCCCTCACAAAGAGCTTGGGGTTGCGGTTTCTGCCGCTGTTGACTCTCACGTGGAGATAATGGAACATCATTTCAGAGTTTCGGAAATGGGAGAGAAATCTCCCAGCAGCCCAGCAGTTGAAGAGGAGCTGCCTCAAATACCAGCCCAACGGGAGGCCTGTCTCTGGCTTTTATGTTCAAGCTGGGACTCTTGGCCTCAGAAGCCTGCTTCTGGTCTTGAAAGTTGGTCCCTTCCCAGCATTATAGCATTAAAAAAATTTTTTTT</dnaseq>|
 
sequence = <dnaseq>GATCCACTAGCCCAGGGCTTCTCAAGCTGGAATGTGGACATGAATCACCATGGATCTGGTTACGTTGCAGATTCTGACTCAGCAGGTCTGAGGCGGGGCCTGACATTCTGCACGGCTGGCCTGCTCCGGGCGCTGCTGATGCTGCTGGTTCCTGGACCACCCTTGAGACCCTGGATGACCTCTGAGGTGCTGCCTCCTTGCAAAAACCCTCAGCTCTTGGGACCTCTCCCTGCGCTTCCGAAGCCCTTTCAGATATTTTCCTGTAGCCCTCACAAAGAGCTTGGGGTTGCGGTTTCTGCCGCTGTTGACTCTCACGTGGAGATAATGGAACATCATTTCAGAGTTTCGGAAATGGGAGAGAAATCTCCCAGCAGCCCAGCAGTTGAAGAGGAGCTGCCTCAAATACCAGCCCAACGGGAGGCCTGTCTCTGGCTTTTATGTTCAAGCTGGGACTCTTGGCCTCAGAAGCCTGCTTCTGGTCTTGAAAGTTGGTCCCTTCCCAGCATTATAGCATTAAAAAAATTTTTTTT</dnaseq>|
 
}}
 
}}
[[Category:Intergenic]][[Category:lnc-ZRANB1-2]]
+
[[Category:Intergenic]][[Category:lnc-ZRANB1-2]][[Category:NONHSAG007127]]

Revision as of 15:04, 13 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

lnc-ZRANB1-2:1

Source

LNCipedia2.1

Same with

NONHSAT016877

Classification

intergenic

Length

530 nt

Genomic location

chr10+:126920240..126922589

Exon number

2

Exons

126920240..126920558,126922379..126922589

Genome context

Sequence
000001 GATCCACTAG CCCAGGGCTT CTCAAGCTGG AATGTGGACA TGAATCACCA TGGATCTGGT TACGTTGCAG ATTCTGACTC 000080
000081 AGCAGGTCTG AGGCGGGGCC TGACATTCTG CACGGCTGGC CTGCTCCGGG CGCTGCTGAT GCTGCTGGTT CCTGGACCAC 000160
000161 CCTTGAGACC CTGGATGACC TCTGAGGTGC TGCCTCCTTG CAAAAACCCT CAGCTCTTGG GACCTCTCCC TGCGCTTCCG 000240
000241 AAGCCCTTTC AGATATTTTC CTGTAGCCCT CACAAAGAGC TTGGGGTTGC GGTTTCTGCC GCTGTTGACT CTCACGTGGA 000320
000321 GATAATGGAA CATCATTTCA GAGTTTCGGA AATGGGAGAG AAATCTCCCA GCAGCCCAGC AGTTGAAGAG GAGCTGCCTC 000400
000401 AAATACCAGC CCAACGGGAG GCCTGTCTCT GGCTTTTATG TTCAAGCTGG GACTCTTGGC CTCAGAAGCC TGCTTCTGGT 000480
000481 CTTGAAAGTT GGTCCCTTCC CAGCATTATA GCATTAAAAA AATTTTTTTT
[back to top]