Difference between revisions of "Lnc-CDH6-2:12"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>CTATAGGTTGGTATGTACCCAATTGTGACTAAACCAAAAGAAACAAATCTGGAAACTGAAGTATCAATACGTGAAAAGCGTTCTTTTGGTATTGGGAGTGCCAGTTGTCTTTGTTTCATGAACTACTTCTCCGTAATAGCATGCAGCCATCTTCAAGAGGTGAGAATTTCACTTAGCGACTTAAACAGAAGTGTTATCTCAAGATAATATAATATCTGGAGGTAAAACAGCATCCCCAGGATAAACAGGATTACTCAAAGTTATT</dnaseq>|
 
sequence = <dnaseq>CTATAGGTTGGTATGTACCCAATTGTGACTAAACCAAAAGAAACAAATCTGGAAACTGAAGTATCAATACGTGAAAAGCGTTCTTTTGGTATTGGGAGTGCCAGTTGTCTTTGTTTCATGAACTACTTCTCCGTAATAGCATGCAGCCATCTTCAAGAGGTGAGAATTTCACTTAGCGACTTAAACAGAAGTGTTATCTCAAGATAATATAATATCTGGAGGTAAAACAGCATCCCCAGGATAAACAGGATTACTCAAAGTTATT</dnaseq>|
 
}}
 
}}
[[Category:Intergenic]][[Category:lnc-CDH6-2]]
+
[[Category:Intergenic]][[Category:lnc-CDH6-2]][[Category:NONHSAG040100]]

Revision as of 15:04, 13 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

lnc-CDH6-2:12

Source

LNCipedia2.1

Same with

NONHSAT100855

Classification

intergenic

Length

265 nt

Genomic location

chr5+:29164518..29183428

Exon number

4

Exons

29164518..29164621,29165037..29165153,29169667..29169693,29183412..29183428

Genome context

Sequence
000001 CTATAGGTTG GTATGTACCC AATTGTGACT AAACCAAAAG AAACAAATCT GGAAACTGAA GTATCAATAC GTGAAAAGCG 000080
000081 TTCTTTTGGT ATTGGGAGTG CCAGTTGTCT TTGTTTCATG AACTACTTCT CCGTAATAGC ATGCAGCCAT CTTCAAGAGG 000160
000161 TGAGAATTTC ACTTAGCGAC TTAAACAGAA GTGTTATCTC AAGATAATAT AATATCTGGA GGTAAAACAG CATCCCCAGG 000240
000241 ATAAACAGGA TTACTCAAAG TTATT
[back to top]