Difference between revisions of "ENST00000504527.1"

From LncRNAWiki
Jump to: navigation, search
(Created page with "Please input one-sentence summary here. ==Annotated Information== ===Transcriptomic Nomeclature=== Please input transcriptomic nomeclature information here. ===Functio...")
 
Line 42: Line 42:
 
sequence = <dnaseq>AGTCCTCACCTCCCACATGCTTTTCATCACCCGCTCTCACATCCCATCTGGGGCCTCTGCTTCCATCCTACCATTTCGCAAGCCTGGCCAACTCAAGCTCCGTGTGCTGCACCTAGAGCAGCCCATCTCTGTGTCAGCTTTCATAAGGAGGAGTCAGAGAAGTAATCTGGAGCCACTAAGAGTCAAAGACAGGAAAAATGGGCTTAAGCAGGAGGAAAATTCCAGCAGGACAAAGAAACACAGGCTGGGAGGTGAGCTGCTCAGTTGCCAGAGTATCAACCTGAGCCCAGGACACTGCCAGACTGCTGAGTCAAAGAGGGTTTAGCAGCCCATTTTCATAGACAGACAGGTGAGAGGAGGATGCTGGACATGGTCCCAGAGACATGGGGACTCAAGAAACATGAAGATCTGTTCACAGCTAAGGGCACATTTCCATGCCGAGAAATCAGGCGTGAGCGCAAGAGTCCTATCGTCTACCAGAAAAAGAAATCTTTGGGTAATTTTTTTCTCTGTCTTATCTCCGAGTTGGGTGGTGAACTGTGGAAACACTGTATTGA</dnaseq>|
 
sequence = <dnaseq>AGTCCTCACCTCCCACATGCTTTTCATCACCCGCTCTCACATCCCATCTGGGGCCTCTGCTTCCATCCTACCATTTCGCAAGCCTGGCCAACTCAAGCTCCGTGTGCTGCACCTAGAGCAGCCCATCTCTGTGTCAGCTTTCATAAGGAGGAGTCAGAGAAGTAATCTGGAGCCACTAAGAGTCAAAGACAGGAAAAATGGGCTTAAGCAGGAGGAAAATTCCAGCAGGACAAAGAAACACAGGCTGGGAGGTGAGCTGCTCAGTTGCCAGAGTATCAACCTGAGCCCAGGACACTGCCAGACTGCTGAGTCAAAGAGGGTTTAGCAGCCCATTTTCATAGACAGACAGGTGAGAGGAGGATGCTGGACATGGTCCCAGAGACATGGGGACTCAAGAAACATGAAGATCTGTTCACAGCTAAGGGCACATTTCCATGCCGAGAAATCAGGCGTGAGCGCAAGAGTCCTATCGTCTACCAGAAAAAGAAATCTTTGGGTAATTTTTTTCTCTGTCTTATCTCCGAGTTGGGTGGTGAACTGTGGAAACACTGTATTGA</dnaseq>|
 
}}
 
}}
[[Category:Intronic(AS)]]
+
[[Category:Intronic(AS)]][[Category:lnc-RARS-4]]

Revision as of 15:05, 13 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000504527.1

Source

Gencode19

Same with

lnc-RARS-4:6,NONHSAT105013

Classification

intronic(AS)

Length

557 nt

Genomic location

chr5+:168440253..168445707

Exon number

3

Exons

168440253..168440389,168444837..168444946,168445398..168445707

Genome context

Sequence
000001 AGTCCTCACC TCCCACATGC TTTTCATCAC CCGCTCTCAC ATCCCATCTG GGGCCTCTGC TTCCATCCTA CCATTTCGCA 000080
000081 AGCCTGGCCA ACTCAAGCTC CGTGTGCTGC ACCTAGAGCA GCCCATCTCT GTGTCAGCTT TCATAAGGAG GAGTCAGAGA 000160
000161 AGTAATCTGG AGCCACTAAG AGTCAAAGAC AGGAAAAATG GGCTTAAGCA GGAGGAAAAT TCCAGCAGGA CAAAGAAACA 000240
000241 CAGGCTGGGA GGTGAGCTGC TCAGTTGCCA GAGTATCAAC CTGAGCCCAG GACACTGCCA GACTGCTGAG TCAAAGAGGG 000320
000321 TTTAGCAGCC CATTTTCATA GACAGACAGG TGAGAGGAGG ATGCTGGACA TGGTCCCAGA GACATGGGGA CTCAAGAAAC 000400
000401 ATGAAGATCT GTTCACAGCT AAGGGCACAT TTCCATGCCG AGAAATCAGG CGTGAGCGCA AGAGTCCTAT CGTCTACCAG 000480
000481 AAAAAGAAAT CTTTGGGTAA TTTTTTTCTC TGTCTTATCT CCGAGTTGGG TGGTGAACTG TGGAAACACT GTATTGA
[back to top]