Difference between revisions of "ZEBTR"

From LncRNAWiki
Jump to: navigation, search
(Created page with "''ZEBTR'', a lncRNA, promotes the proliferation and invasion of pancreatic cancer cells. ==Annotated Information== ===Name=== Approved symbol: ''ZEBTR'' Approved name: ''ZEB...")
 
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
 
''ZEBTR'', a lncRNA, promotes the proliferation and invasion of pancreatic cancer cells.
 
''ZEBTR'', a lncRNA, promotes the proliferation and invasion of pancreatic cancer cells.
 +
 
==Annotated Information==
 
==Annotated Information==
 +
 
===Name===
 
===Name===
 +
[[File:ZEBTR1.png|right|thumb|300px|Knockdown of ''ZEBTR'' inhibited proliferation, colony formation, migration, and invasion of Pancreatic cancer cells<ref name="ref1" />.]]
 +
[[File:ZNBTR2.png|right|thumb|300px|The expression profile, cellular location, and distribution of ''ZEBTR''<ref name="ref1" />.]]
 
Approved symbol: ''ZEBTR''
 
Approved symbol: ''ZEBTR''
  
Line 11: Line 15:
  
 
Entrez Gene: 113391337
 
Entrez Gene: 113391337
[[File:ZEBTR1.png|right|thumb|400px|Knockdown of ''ZEBTR'' inhibited proliferation, colony formation, migration, and invasion of Pancreatic cancer cells<ref name="ref1" />.]]
 
[[File:ZNBTR2.png|right|thumb|400px|The expression profile, cellular location, and distribution of ''ZEBTR''<ref name="ref1" />.]]
 
  
 
===Characteristics===
 
===Characteristics===
Line 35: Line 37:
  
 
===Evolution===
 
===Evolution===
 +
===Sequence===
 +
>BX111887.1 BX111887 Soares_testis_NHT Homo sapiens cDNA clone IMAGp998N224461; IMAGE:1755477 5', mRNA sequence
 +
<dnaseq>GCGCCCCACCCCGAAGCCCGGGCTGCGAGGCGGAGTCAGGGCCCCCTCAGCTCCACCCCGAAGCTTGGCATGATTTGCCATTTTACTGCTCCTCTGGAATCTGTGCTTCCTCCCGAGCGCAGGAGGTTCCCCTGCCGCGGCTGCCGGCCCCAGGACCTGGATGGAGATCGCCCGAGGAGAATCCGTTCTCCTGGTCACACTACAGAGGCC
 +
TAGGGGGACGAGACCTGCGGGGCCTGTCCGGACCCGAGGCGGCGCTCGGGATGGTCTCCCGTGGAGCAGA
 +
AACGCCGTTTCCTGGTATTTACAACCCTCCCGACTCCCGGGGAGAGGGCGGCATAGGCAGCCAATCAGGA
 +
TGCAGTCGTCTCTAAAGGTCAGGGTGACACACATTTCCCAAGATCATTCACGGACTTCGCCCTTCGATGC
 +
CTTGTTCTCATGACAAAACCTGGCTGCCAGCACTTAATGTGATTTCCCCCCATCTCTGGCAACTGAGAGA
 +
ATAAAAAACT</dnaseq>
  
 
==Labs working on this lncRNA==
 
==Labs working on this lncRNA==
  
* Department of Pancreatic Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China
+
* Department of Pancreatic Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China.
 
==References==
 
==References==
 
<references>
 
<references>
Line 45: Line 55:
 
</ref>(1)
 
</ref>(1)
 
</references>
 
</references>
 
===Sequence===
 
>BX111887.1 BX111887 Soares_testis_NHT Homo sapiens cDNA clone IMAGp998N224461; IMAGE:1755477 5', mRNA sequence
 
<dnaseq>GCGCCCCACCCCGAAGCCCGGGCTGCGAGGCGGAGTCAGGGCCCCCTCAGCTCCACCCCGAAGCTTGGCATGATTTGCCATTTTACTGCTCCTCTGGAATCTGTGCTTCCTCCCGAGCGCAGGAGGTTCCCCTGCCGCGGCTGCCGGCCCCAGGACCTGGATGGAGATCGCCCGAGGAGAATCCGTTCTCCTGGTCACACTACAGAGGCC
 
TAGGGGGACGAGACCTGCGGGGCCTGTCCGGACCCGAGGCGGCGCTCGGGATGGTCTCCCGTGGAGCAGA
 
AACGCCGTTTCCTGGTATTTACAACCCTCCCGACTCCCGGGGAGAGGGCGGCATAGGCAGCCAATCAGGA
 
TGCAGTCGTCTCTAAAGGTCAGGGTGACACACATTTCCCAAGATCATTCACGGACTTCGCCCTTCGATGC
 
CTTGTTCTCATGACAAAACCTGGCTGCCAGCACTTAATGTGATTTCCCCCCATCTCTGGCAACTGAGAGA
 
ATAAAAAACT</dnaseq>
 

Latest revision as of 01:47, 13 August 2019

ZEBTR, a lncRNA, promotes the proliferation and invasion of pancreatic cancer cells.

Annotated Information

Name

Knockdown of ZEBTR inhibited proliferation, colony formation, migration, and invasion of Pancreatic cancer cells[1].
The expression profile, cellular location, and distribution of ZEBTR[1].

Approved symbol: ZEBTR

Approved name: ZEBTR : ZEB1 transcriptional regulator RNA

HGNC ID: HGNC: 53967

Alias symbols: LncRNA-BX111

Entrez Gene: 113391337

Characteristics

Function

  • ZEBTR promotes the proliferation and invasion of pancreatic cancer cells. Mechanically, BX111 activated transcription of ZEB1, a key regulator for epithelia-mesenchymal transition (EMT), via recruiting transcriptional factor Y-box protein (YB1) to its promoter region[1].
  • In addition, ZEBTR contributes to the hypoxia-induced EMT of pancreatic cells by regulating expression of ZEB1 and its downstream proteins E-cadherin and MMP2[1].

Regulation

ZEBTR transcription is induced by hypoxia-inducible factor (HIF-1α) in response to hypoxia[1].

Diseases

Pancreatic cancer [1].

Expression

ZEBTR is overexpressed in human Pancreatic cancer[1].

Evolution

Sequence

>BX111887.1 BX111887 Soares_testis_NHT Homo sapiens cDNA clone IMAGp998N224461; IMAGE:1755477 5', mRNA sequence

000001 GCGCCCCACC CCGAAGCCCG GGCTGCGAGG CGGAGTCAGG GCCCCCTCAG CTCCACCCCG AAGCTTGGCA TGATTTGCCA 000080
000081 TTTTACTGCT CCTCTGGAAT CTGTGCTTCC TCCCGAGCGC AGGAGGTTCC CCTGCCGCGG CTGCCGGCCC CAGGACCTGG 000160
000161 ATGGAGATCG CCCGAGGAGA ATCCGTTCTC CTGGTCACAC TACAGAGGCC TAGGGGGACG AGACCTGCGG GGCCTGTCCG 000240
000241 GACCCGAGGC GGCGCTCGGG ATGGTCTCCC GTGGAGCAGA AACGCCGTTT CCTGGTATTT ACAACCCTCC CGACTCCCGG 000320
000321 GGAGAGGGCG GCATAGGCAG CCAATCAGGA TGCAGTCGTC TCTAAAGGTC AGGGTGACAC ACATTTCCCA AGATCATTCA 000400
000401 CGGACTTCGC CCTTCGATGC CTTGTTCTCA TGACAAAACC TGGCTGCCAG CACTTAATGT GATTTCCCCC CATCTCTGGC 000480
000481 AACTGAGAGA ATAAAAAACT

Labs working on this lncRNA

  • Department of Pancreatic Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China.

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Shi-jiang Deng, Heng-yu Chen, Zeng Ye, Shi-chang Deng, Shuai Zhu, Zhu Zeng, Chi He, Ming-liang Liu, Kang Huang1, Jian-xin Zhong, Feng-yu Xu, Qiang Li1, Yang Liu1, Chun-you Wang and Gang Zhao. Hypoxia-induced LncRNA-BX111 promotes metastasis and progression of pancreatic cancer through regulating ZEB1 transcription. Oncogene. 2018 Nov;37(44):5811-5828.