Difference between revisions of "VIM-AS1"

From LncRNAWiki
Jump to: navigation, search
(Created page with "==Annotation== ===Name=== VIM-AS1 ===Alias=== NA ===Disease=== Disease: endometrial cancer [http://www.ncbi.nlm.nih.gov/pubmed/28881755 (PMID:28881755)] Dysfunction type: e...")
 
Line 1: Line 1:
==Annotation==
+
 
 +
==Annotated Information==
 
===Name===
 
===Name===
VIM-AS1
+
Approved symbol: ''VIM-AS1''
  
===Alias===
+
Approved name: ''VIM-AS1'':  VIM antisense RNA 1
NA
 
  
===Disease===
+
Alias symbols: -
Disease: endometrial cancer [http://www.ncbi.nlm.nih.gov/pubmed/28881755 (PMID:28881755)]
 
  
Dysfunction type: expression
+
HGNC ID: HGNC: 44879
  
Description: Top five lncRNAs (FLJ27354,sRP11–275I14.4,sVIM-AS1,sCTB-51J22.1sandsRP11-229P13.20) in the ranked list were selected as optimal predictive lncRNA biomarkers of UCEC progression
+
Ensembl ID: ENSG00000229124
  
 +
LncBook transcript ID: HSALNT0159506
 +
 +
===Characteristics===
 +
VIM-AS1 was reported as one of the optimal predictive lncRNA biomarkers of UCEC progression<ref name="ref1" />.
  
 
===Function===
 
===Function===
Function Mechanism: NA [http://www.ncbi.nlm.nih.gov/pubmed/28881755 (PMID:28881755)]
+
* ''VIM-AS1''  promotes tumor growth and metastasis by inducing EMT in colorectal cancer (CRC) cells<ref name="ref2" />.
 +
 
 +
===Regulation===
 +
-
 +
===Diseases===
 +
Endometrial cancer<ref name="ref1" />.
 +
 
 +
Colorectal cancer<ref name="ref2" />.
 +
 
 +
===Expression===
 +
''VIM-AS1''  transcript was significantly upregulated in high-grade, lymph node metastasis and vascular invasion tumors<ref name="ref2" />.
 +
 
 +
===Evolution===
 +
-
  
Biological Process: pathogenic process
+
==Labs working on this lncRNA==
 +
* Department of Biotechnology, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran.
 +
==References==
 +
<references>
 +
<ref name="ref1">
 +
Sun Y, Zou X, He J, et al. Identification of long non-coding RNAs biomarkers associated with progression of endometrial carcinoma and patient outcomes[J]. Oncotarget, 2017, 8(32): 52604.
 +
</ref>(1)
 +
<ref name="ref2">
 +
Asadi M H, Yaghoobi M M. Long noncoding RNA VIM-AS1 promotes colorectal cancer progression and metastasis by inducing EMT[J]. European journal of cell biology, 2018, 97(4): 279-288.
 +
</ref>(2)
 +
</references>
  
Description: biomarker
+
===Sequence===
 +
>NR_108061.1 Homo sapiens VIM antisense RNA 1 (VIM-AS1), transcript variant 1, long non-coding RNA
 +
<dnaseq>TTCTCCCGGAGGCGCATGATGTCCTCGGCCAGGTTGTCGCGCTCCACCTCGACGCGGGCTTTGTCGTTGG
 +
TTAGCTGGTCCACCTGCCGGCGCAGCTCCCGCATCTCCTCCTCGTAGAGGTCCCCCAGGCGCGACTTGCC
 +
TTGGCCCTTGAGCTGCTCGAGCTCGGCCAGCAGGATCTTATTCTGCTGCTCCAGGAAGCGCACCTTGTCG
 +
ATGTAGTTGGCGAAGCGGTCATTCAGCTCCTGCAGCTCCACCTTCTCGTTGGTGCGGGTGTTCTTGAACT
 +
CGGTGTTGATGGCGTCGGCCAGCGAGAAGTCCACCGAGTCCTGCAGGAGCCGCACCCCGGGCACGCTGCT
 +
CCGCAGGCGCACGGCAGAGGAGCGCGTGGCATACACGCCGCCCGGGGACGAGGCGTAGAGGCTGCGGCTG
 +
GTGCTGGGGCGCAGCGCGCTGCCCAGGCTGTAGGTGCGGGTGGACGTAGTCACGTAGCTCCGGCTGGAGC
 +
TCGGCCGGCTCGCGGTGCCCGGGCCGCCGAACATCCTGCGGTAGGAGGACGAGGACACGGACCTGGTGGA
 +
CATGGCTGCGGAGGGTGGCGATGGCCTGGGCGGCGGCGGTGGCGCGGACTGGCTCCCGGAGAAGAGGCGA
 +
ACGAGGGCGCGACAGCAAAGCTCCCTTTGGATGACATAGATTTATTACTTAGTAGTATATTATGTATTGG
 +
CTGTCCCACATTTTGAAATTTAATGGACTCGTGGTGATCAGAATAAAAGAAGCCTTCGATGTGAGGCCCA
 +
GGCATTGAGTACCATGTGTGCGATTCACAAGCCTTGGCATCTGAACAATTTTTTGGAAGGATCCATCAGG
 +
ACAACACGTCGGGGGTGTACTAGTGAAGTGATTTTCCAAATGTGCTACTCAGACCTGTAGCATCAGCATC
 +
ACCGGATAATTTGTTAGAAATTCCAACTGTTAGGCCCCACTTTAGACCAACTGAATGTGAAACTCTGGGA
 +
GTACGTGGGGCCCAGCAATTTGTGTTTTTACAAGACTTACCAGGTGATTCTGAGAACCACTGTGCTAGTG
 +
AATTGTTCCTGTCTGTGGCCACGTAGAATAAGAAAACCATAGGGTTGGAAAATGGGGAAACTGGTGAGTG
 +
TTCGCTTATGAGGAAATGAAGAATAGATAGAAAAGAATTAGTTAACTTTTGGAATTCAAAAGAGAAGCAG
 +
TTTGTAAAAGCCAGGAATTTGATTTGAAGGACTAATTGCTTGCAGAATCTTTGCTTTCTCAGAGAGGGGC
 +
AATCCAGATCACTAGGTTACCGTGAAATATGTTGGTATGGCTCTAAAATTCTAGAATAATCTCTCTAGTG
 +
AGAAAAGGCATACCTTTCCATATTAGGACAAAACTTCAAATCAGGTTTGTAAAATCCTATAAGATTATTG
 +
TATCCCATTGCCATGGCCAACTTGTTTGTCTCTGGAGATCCCAGTTTCTACATCTGAAAACCATATGCAT
 +
TCCTGCTCACCAGGAATTATCTCGCTGAATGAAGCAAGAGATTCAGGATGTGTAAGAGAATTTATGAAGC
 +
ATTTGGATTACCAAGAAATGTGAAGTATAAAGATCAAGAATGATTATTACAAACACTGATGGTAAAGAGG
 +
TGTTTCGAAGTCGATGCAAAAAATGAGTTGCTTATTTCAGTCTCTCTTTGATATATCTGCCTTTTTAGTG
 +
CTGACTCTATCATGTATTCACTATTTGATTTTCAGTGAATCACATTTTTTAAAGCTTTTAATCTGTTTCC
 +
TCAAAAAATATATTTTTTAAAAATATTTACTCAGGATTGTTGTGAGAATAAAATTGATTCGATTGATATT
 +
TCAAAAAAGAAATATATTTTTAAAAAATAAAGCAATACCATTTTTGGATATGCTAAAAAAAAA</dnaseq>

Revision as of 08:14, 5 August 2019

Annotated Information

Name

Approved symbol: VIM-AS1

Approved name: VIM-AS1: VIM antisense RNA 1

Alias symbols: -

HGNC ID: HGNC: 44879

Ensembl ID: ENSG00000229124

LncBook transcript ID: HSALNT0159506

Characteristics

VIM-AS1 was reported as one of the optimal predictive lncRNA biomarkers of UCEC progression[1].

Function

  • VIM-AS1 promotes tumor growth and metastasis by inducing EMT in colorectal cancer (CRC) cells[2].

Regulation

-

Diseases

Endometrial cancer[1].

Colorectal cancer[2].

Expression

VIM-AS1 transcript was significantly upregulated in high-grade, lymph node metastasis and vascular invasion tumors[2].

Evolution

-

Labs working on this lncRNA

  • Department of Biotechnology, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran.

References

  1. 1.0 1.1 Sun Y, Zou X, He J, et al. Identification of long non-coding RNAs biomarkers associated with progression of endometrial carcinoma and patient outcomes[J]. Oncotarget, 2017, 8(32): 52604.
  2. 2.0 2.1 2.2 Asadi M H, Yaghoobi M M. Long noncoding RNA VIM-AS1 promotes colorectal cancer progression and metastasis by inducing EMT[J]. European journal of cell biology, 2018, 97(4): 279-288.

Sequence

>NR_108061.1 Homo sapiens VIM antisense RNA 1 (VIM-AS1), transcript variant 1, long non-coding RNA

000001 TTCTCCCGGA GGCGCATGAT GTCCTCGGCC AGGTTGTCGC GCTCCACCTC GACGCGGGCT TTGTCGTTGG TTAGCTGGTC 000080
000081 CACCTGCCGG CGCAGCTCCC GCATCTCCTC CTCGTAGAGG TCCCCCAGGC GCGACTTGCC TTGGCCCTTG AGCTGCTCGA 000160
000161 GCTCGGCCAG CAGGATCTTA TTCTGCTGCT CCAGGAAGCG CACCTTGTCG ATGTAGTTGG CGAAGCGGTC ATTCAGCTCC 000240
000241 TGCAGCTCCA CCTTCTCGTT GGTGCGGGTG TTCTTGAACT CGGTGTTGAT GGCGTCGGCC AGCGAGAAGT CCACCGAGTC 000320
000321 CTGCAGGAGC CGCACCCCGG GCACGCTGCT CCGCAGGCGC ACGGCAGAGG AGCGCGTGGC ATACACGCCG CCCGGGGACG 000400
000401 AGGCGTAGAG GCTGCGGCTG GTGCTGGGGC GCAGCGCGCT GCCCAGGCTG TAGGTGCGGG TGGACGTAGT CACGTAGCTC 000480
000481 CGGCTGGAGC TCGGCCGGCT CGCGGTGCCC GGGCCGCCGA ACATCCTGCG GTAGGAGGAC GAGGACACGG ACCTGGTGGA 000560
000561 CATGGCTGCG GAGGGTGGCG ATGGCCTGGG CGGCGGCGGT GGCGCGGACT GGCTCCCGGA GAAGAGGCGA ACGAGGGCGC 000640
000641 GACAGCAAAG CTCCCTTTGG ATGACATAGA TTTATTACTT AGTAGTATAT TATGTATTGG CTGTCCCACA TTTTGAAATT 000720
000721 TAATGGACTC GTGGTGATCA GAATAAAAGA AGCCTTCGAT GTGAGGCCCA GGCATTGAGT ACCATGTGTG CGATTCACAA 000800
000801 GCCTTGGCAT CTGAACAATT TTTTGGAAGG ATCCATCAGG ACAACACGTC GGGGGTGTAC TAGTGAAGTG ATTTTCCAAA 000880
000881 TGTGCTACTC AGACCTGTAG CATCAGCATC ACCGGATAAT TTGTTAGAAA TTCCAACTGT TAGGCCCCAC TTTAGACCAA 000960
000961 CTGAATGTGA AACTCTGGGA GTACGTGGGG CCCAGCAATT TGTGTTTTTA CAAGACTTAC CAGGTGATTC TGAGAACCAC 001040
001041 TGTGCTAGTG AATTGTTCCT GTCTGTGGCC ACGTAGAATA AGAAAACCAT AGGGTTGGAA AATGGGGAAA CTGGTGAGTG 001120
001121 TTCGCTTATG AGGAAATGAA GAATAGATAG AAAAGAATTA GTTAACTTTT GGAATTCAAA AGAGAAGCAG TTTGTAAAAG 001200
001201 CCAGGAATTT GATTTGAAGG ACTAATTGCT TGCAGAATCT TTGCTTTCTC AGAGAGGGGC AATCCAGATC ACTAGGTTAC 001280
001281 CGTGAAATAT GTTGGTATGG CTCTAAAATT CTAGAATAAT CTCTCTAGTG AGAAAAGGCA TACCTTTCCA TATTAGGACA 001360
001361 AAACTTCAAA TCAGGTTTGT AAAATCCTAT AAGATTATTG TATCCCATTG CCATGGCCAA CTTGTTTGTC TCTGGAGATC 001440
001441 CCAGTTTCTA CATCTGAAAA CCATATGCAT TCCTGCTCAC CAGGAATTAT CTCGCTGAAT GAAGCAAGAG ATTCAGGATG 001520
001521 TGTAAGAGAA TTTATGAAGC ATTTGGATTA CCAAGAAATG TGAAGTATAA AGATCAAGAA TGATTATTAC AAACACTGAT 001600
001601 GGTAAAGAGG TGTTTCGAAG TCGATGCAAA AAATGAGTTG CTTATTTCAG TCTCTCTTTG ATATATCTGC CTTTTTAGTG 001680
001681 CTGACTCTAT CATGTATTCA CTATTTGATT TTCAGTGAAT CACATTTTTT AAAGCTTTTA ATCTGTTTCC TCAAAAAATA 001760
001761 TATTTTTTAA AAATATTTAC TCAGGATTGT TGTGAGAATA AAATTGATTC GATTGATATT TCAAAAAAGA AATATATTTT 001840
001841 TAAAAAATAA AGCAATACCA TTTTTGGATA TGCTAAAAAA AAA