Difference between revisions of "SBF2-AS1"

From LncRNAWiki
Jump to: navigation, search
(Created page with "==Annotation== ===Name=== SBF2-AS1 ===Alias=== NA ===Disease=== Disease: non-small cell lung cancer [http://www.ncbi.nlm.nih.gov/pubmed/27154193 (PMID:27154193)] Dysfunctio...")
 
Line 1: Line 1:
 
==Annotation==
 
==Annotation==
 
===Name===
 
===Name===
SBF2-AS1
+
Approved symbol: BF2-AS1
  
===Alias===
+
Approved name: SBF2 antisense RNA 1
NA
 
  
===Disease===
+
HGNC ID: HGNC:27438
Disease: non-small cell lung cancer [http://www.ncbi.nlm.nih.gov/pubmed/27154193 (PMID:27154193)]
 
  
Dysfunction type: expression
+
EnsemblID: ENSG00000246273
  
Description: SBF2-AS1 may serve as a novel biomarker and potential therapeutic target for NSCLC patients.
+
LncBook transcript ID: HSALNT0290236
  
 +
===Characteristics===
 +
-
 +
===Function===
 +
[[File:SBF2-AS1-fun.jpg|right|thumb|300px|The Schematic representation of NFAT5/SBF2-AS1/miR-338-3p/EGFL7 axis in GBM cell-driven angiogenesis<ref name="ref2" />.]]
 +
[[File:SBF2-AS1-exp.jpg|right|thumb|400px|Downregulation of SBF2-AS1 inhibited GBM cell-driven angiogenesis in vitro<ref name="ref2" />.]]
 +
 +
*SBF2-AS1 is upregulated in non-small cell lung cancer (NSCLC) and promotes proliferation of NSCLC tumor cells. SBF2-AS1 may serve as a novel biomarker and potential therapeutic target for NSCLC patients<ref name="ref1" />.
 +
 +
*knockdown of SBF2-AS1 repressed GBM cell-driven angiogenesis via enhancing the inhibitory effect of miR-338-3p on EGF like domain multiple 7 (EGFL7). In vivo study demonstrated that the combination of NFAT5 knockdown and SBF2-AS1 knockdown produced the smallest xenograft volume and the lowest microvessel density. NFAT5/SBF2-AS1/miR-338-3p/EGFL7 pathway may provide novel targets for glioma anti-angiogenic treatment<ref name="ref2" />.
 +
===Regulation===
 +
NFAT5 regulated SBF2-AS1 at transcriptional level, and SBF2-AS1 might be involved in NFAT5-mediated GBM cell-driven angiogenesis<ref name="ref2" />.
 +
===Diseases===
 +
Non-small cell lung cancer (NSCLC)<ref name="ref1" />
 +
 +
Glioblastoma (GBM)<ref name="ref2" />
 +
===Expression===
 +
SBF2-AS1 is upregulated in non-small cell lung cancer<ref name="ref1" />.
  
===Function===
+
SBF2-AS1 is upregulated in glioma samples<ref name="ref2" />.
Function Mechanism: transcriptional regulation [http://www.ncbi.nlm.nih.gov/pubmed/27154193 (PMID:27154193)]
+
 
 +
===Evolution===
 +
-
  
Biological Process: pathogenic process
+
==Labs working on this lncRNA==
 +
*Department of Thoracic Surgery, Huai'an First People's Hospital, Nanjing Medical University, 6 West Beijing Rd, Huai'an, 223300, China.
 +
*Department of Neurosurgery, Shengjing Hospital of China Medical University, Shenyang, China.
 +
==References==
 +
<references>
 +
<ref name="ref1">
 +
Lv J, Qiu M, Xia W, et al. High expression of long non-coding RNA SBF2-AS1 promotes proliferation in non-small cell lung cancer[J]. Journal of Experimental & Clinical Cancer Research, 2016, 35(1): 75.
 +
</ref>(1)
 +
<ref name="ref2">
 +
Yu H, Zheng J, Liu X, et al. Transcription factor NFAT5 promotes glioblastoma cell-driven angiogenesis via SBF2-AS1/miR-338-3p-mediated EGFL7 expression change[J]. Frontiers in molecular neuroscience, 2017, 10: 301.
 +
</ref>(2)
 +
</references>
  
Description: biomarker
+
===Sequence===
 +
>NR_036485.1 Homo sapiens SBF2 antisense RNA 1 (SBF2-AS1), long non-coding RNA
 +
<dnaseq>CAGGTTCCAGCCCCGACCCGGGCGCGCGGGGCCGACTAGGGTCGGGTCCAGTGTGCGGTGGTCGCTCCGC
 +
TCCGGGCCGCTCCGCTCTGGGCGTCAGGGCGCGGGGAGCTGCCCCGGGGTTCTGTCCACCGGGGAGGAAA
 +
GCCACGAGCACTGAGCGCCTCCTGAGAGCCAGCCCTGACGTGAACTCATTTTATCTGCCACGACCCAGAA
 +
GGAGTCTACTGCTAAGATTTCAGCATGTCCTGTGGCTGAGTTAATCAGAGTTATGACAGGAAGGTACCGG
 +
GCACACCATCGCAATGCTCCATCAATGCTAGTATGTTGTGTTCTTTCCTTCATATCAAGTCAACTCAAGC
 +
TTGCTCTACTTACCTGGTGTACACAGTCTAAGAACTGTAAGAAGACTGGAGCAAAACCACTCCCCTGACA
 +
GTTGAGGGTCAAGCTGCTCCTCTGACTGAATTTGTGACCAAAAGAGAGCCACTCTTTTTCAACCAACATC
 +
TGGAAGCCTTCAAGTGTCCTATAAAAGGGATCACTGAGTAACTGAACCAGGGATGTCACCTAGGGCATAA
 +
GCAGGATGGATTGTCATTAATTTTAGTTCTGAAAAAGGCCTATTACTAAGATAAAAGCACTTCCTTCTGA
 +
TGATAGCTAATTCACAAATTTACCTGGACAGCAAATTTGTTCACTAACCATTCCAGGATGGCCAATAAAA
 +
TTAATTTTGTAAACTTGCCAGTAAAAACTAAAGCTCAAATTCATTTTGGCTACAAGTTTACTTTCAGGGA
 +
ATTGAGACTTTAATCCTTAACTGGCCAGTTTGCTGACAGCAACCTTTTCCTAAGTTAATCAGAGGCCAGA
 +
GGATCAGTTAAAATCAATTCTACTTTTTGGCAGATGCAGATTAATGTCTTAATGTAGTCTGAACTCACAC
 +
TTTTCACTCTGGAGTGAGTTAAGGCGGGGCTTATAGAGAGCCAGGGGATGGACTGACAAAACCCAGGAAG
 +
GATGGTCCACGCCTCACACTGCTGGTCAAGGGCTCCATCCGCAAGCCTGCATGGTACATCTGTGGATGGG
 +
AGAGCTTGATGCCCGGAGCCAGAGCTCCAGGCTGCGTAGGGGCTAAGAGCTCATGGTACGGAGTTTTCTG
 +
ATGGATACCAGGTGCTGTTTAACACAGGACTTTCTCTGTCCATAAACACATTAGTCATTATACAAAAGAG
 +
TCATCTGAAGAATTTAAAAATGACCAAATGGAAATATAAATATAAAATATCAAAAAATATGTCTAATAGT
 +
TTACTTGTGCAGTGATGTCCCAGCCTTCCTCCAAACAGACCAAAACTGAGGAACCATTCTCAAGTACTTC
 +
TGATACAACCACAGCCAGCTGCATTATCCTGTGAAGCTAAGAGACAGGAAGGAGAACACAATTAGACCAA
 +
GCGCTTTCTGAGTGCAGAAGTCAGAGAGAGTTGCTTTCAACCCTGGATAATCAAACGACTTAGGGATAAA
 +
GCGCTTGCACAAAAGAACCACATAATGTTTTAAATACCTAAAGTTCTTTCAAATCAAGATTAAACAATGA
 +
CACTTTTGACTGGATGCAATGACTCATGCCCATAATCCCAGCACTTTGGGAGGCCGAGCCGGGCAGGTCA
 +
TTTGAGGTTCGGAGTTCGAGACCAGCCTGGGCAACATAAGCAAGACCCTGTCTCGAAAAATAAAAATAAA
 +
AAAGATACTCCTATTTGTCTATACTGTGTACTAAATGAGAAAAAAACTTTCAATATATTTGTGCTAAGTT
 +
TTTAAAGCCACATCAATTGGCTCAAAGTCCTTAATAAACAATTAAGGTATGAGAATAGTATATAGATTTT
 +
AAAACCAGATGTATAACATTGTAATTTTAAAAAATATTTTAATGATCATCAGACATAATTTGCAATTTGA
 +
ATCCAACTCTGAACAAGAACAAAAATGAAAAAACCCATCTCTTAAACAGAGCTAGGCTACTTTAAACACA
 +
GGAATAAGGCAAATGCCCTACTCAGTAATGAGAAGCTCCTCATGTAACTGTTTCTACAACATAGCTATCA
 +
CCAGGCCTGAATTCTTTTGGGCTCAGAATTTGTTCTAAGAAATGGCTATTATTAAAAAGTCAAAAAATAA
 +
CAGATGCTGGCGAGCCTGTGGAGAAAAGGGAATGTATATACATTTCTGGTGGGAATGTAAATTAGTTCAG
 +
CCATTGTAGAAAGTAGTTTGGTGATTTCTCAAATAACTTAAAACAGAATTACCATTTGACCTAGCAATCC
 +
CATTACTGAGTATATACCCAAAGGAATATAAATTGTTCTACCATAAAGTCACATGCACACACATGTTCAG
 +
TGCTGTACTATTCACAATAGCAAAGACATGGAGTCAACCTATATGCCCATCAACGGTAGACTGGATAAAG
 +
AAAATATGGTACATATACACCATGGAATACTACACAGCCATAAAAAGAATGAGCTTATGTCCTTTGCAGT
 +
AACACAGCTGAAGCAAACTAACACAGGAATGGAAAACCAAATACTGCATATTCTCACTTATAAGTGGGAG
 +
CTAAACATTGAGTACACATGGACACAAAGAAAGGAATAGACGCCTGGGGCGTATTTGAGGTTGGAGGTGA
 +
GAGGAGGGTGAGGATAGAAAAACTACCTATCAGGTACTATGCTTATTACCTGGGTGATGAAATAATCTGT
 +
ACACCAAACTCCCAAGATATGCAATGTACCTATACAACAAACCTACAT</dnaseq>

Revision as of 03:29, 12 August 2019

Annotation

Name

Approved symbol: BF2-AS1

Approved name: SBF2 antisense RNA 1

HGNC ID: HGNC:27438

EnsemblID: ENSG00000246273

LncBook transcript ID: HSALNT0290236

Characteristics

-

Function

The Schematic representation of NFAT5/SBF2-AS1/miR-338-3p/EGFL7 axis in GBM cell-driven angiogenesis[1].
Downregulation of SBF2-AS1 inhibited GBM cell-driven angiogenesis in vitro[1].
  • SBF2-AS1 is upregulated in non-small cell lung cancer (NSCLC) and promotes proliferation of NSCLC tumor cells. SBF2-AS1 may serve as a novel biomarker and potential therapeutic target for NSCLC patients[2].
  • knockdown of SBF2-AS1 repressed GBM cell-driven angiogenesis via enhancing the inhibitory effect of miR-338-3p on EGF like domain multiple 7 (EGFL7). In vivo study demonstrated that the combination of NFAT5 knockdown and SBF2-AS1 knockdown produced the smallest xenograft volume and the lowest microvessel density. NFAT5/SBF2-AS1/miR-338-3p/EGFL7 pathway may provide novel targets for glioma anti-angiogenic treatment[1].

Regulation

NFAT5 regulated SBF2-AS1 at transcriptional level, and SBF2-AS1 might be involved in NFAT5-mediated GBM cell-driven angiogenesis[1].

Diseases

Non-small cell lung cancer (NSCLC)[2]

Glioblastoma (GBM)[1]

Expression

SBF2-AS1 is upregulated in non-small cell lung cancer[2].

SBF2-AS1 is upregulated in glioma samples[1].

Evolution

-

Labs working on this lncRNA

  • Department of Thoracic Surgery, Huai'an First People's Hospital, Nanjing Medical University, 6 West Beijing Rd, Huai'an, 223300, China.
  • Department of Neurosurgery, Shengjing Hospital of China Medical University, Shenyang, China.

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Yu H, Zheng J, Liu X, et al. Transcription factor NFAT5 promotes glioblastoma cell-driven angiogenesis via SBF2-AS1/miR-338-3p-mediated EGFL7 expression change[J]. Frontiers in molecular neuroscience, 2017, 10: 301.
  2. 2.0 2.1 2.2 Lv J, Qiu M, Xia W, et al. High expression of long non-coding RNA SBF2-AS1 promotes proliferation in non-small cell lung cancer[J]. Journal of Experimental & Clinical Cancer Research, 2016, 35(1): 75.

Sequence

>NR_036485.1 Homo sapiens SBF2 antisense RNA 1 (SBF2-AS1), long non-coding RNA

000001 CAGGTTCCAG CCCCGACCCG GGCGCGCGGG GCCGACTAGG GTCGGGTCCA GTGTGCGGTG GTCGCTCCGC TCCGGGCCGC 000080
000081 TCCGCTCTGG GCGTCAGGGC GCGGGGAGCT GCCCCGGGGT TCTGTCCACC GGGGAGGAAA GCCACGAGCA CTGAGCGCCT 000160
000161 CCTGAGAGCC AGCCCTGACG TGAACTCATT TTATCTGCCA CGACCCAGAA GGAGTCTACT GCTAAGATTT CAGCATGTCC 000240
000241 TGTGGCTGAG TTAATCAGAG TTATGACAGG AAGGTACCGG GCACACCATC GCAATGCTCC ATCAATGCTA GTATGTTGTG 000320
000321 TTCTTTCCTT CATATCAAGT CAACTCAAGC TTGCTCTACT TACCTGGTGT ACACAGTCTA AGAACTGTAA GAAGACTGGA 000400
000401 GCAAAACCAC TCCCCTGACA GTTGAGGGTC AAGCTGCTCC TCTGACTGAA TTTGTGACCA AAAGAGAGCC ACTCTTTTTC 000480
000481 AACCAACATC TGGAAGCCTT CAAGTGTCCT ATAAAAGGGA TCACTGAGTA ACTGAACCAG GGATGTCACC TAGGGCATAA 000560
000561 GCAGGATGGA TTGTCATTAA TTTTAGTTCT GAAAAAGGCC TATTACTAAG ATAAAAGCAC TTCCTTCTGA TGATAGCTAA 000640
000641 TTCACAAATT TACCTGGACA GCAAATTTGT TCACTAACCA TTCCAGGATG GCCAATAAAA TTAATTTTGT AAACTTGCCA 000720
000721 GTAAAAACTA AAGCTCAAAT TCATTTTGGC TACAAGTTTA CTTTCAGGGA ATTGAGACTT TAATCCTTAA CTGGCCAGTT 000800
000801 TGCTGACAGC AACCTTTTCC TAAGTTAATC AGAGGCCAGA GGATCAGTTA AAATCAATTC TACTTTTTGG CAGATGCAGA 000880
000881 TTAATGTCTT AATGTAGTCT GAACTCACAC TTTTCACTCT GGAGTGAGTT AAGGCGGGGC TTATAGAGAG CCAGGGGATG 000960
000961 GACTGACAAA ACCCAGGAAG GATGGTCCAC GCCTCACACT GCTGGTCAAG GGCTCCATCC GCAAGCCTGC ATGGTACATC 001040
001041 TGTGGATGGG AGAGCTTGAT GCCCGGAGCC AGAGCTCCAG GCTGCGTAGG GGCTAAGAGC TCATGGTACG GAGTTTTCTG 001120
001121 ATGGATACCA GGTGCTGTTT AACACAGGAC TTTCTCTGTC CATAAACACA TTAGTCATTA TACAAAAGAG TCATCTGAAG 001200
001201 AATTTAAAAA TGACCAAATG GAAATATAAA TATAAAATAT CAAAAAATAT GTCTAATAGT TTACTTGTGC AGTGATGTCC 001280
001281 CAGCCTTCCT CCAAACAGAC CAAAACTGAG GAACCATTCT CAAGTACTTC TGATACAACC ACAGCCAGCT GCATTATCCT 001360
001361 GTGAAGCTAA GAGACAGGAA GGAGAACACA ATTAGACCAA GCGCTTTCTG AGTGCAGAAG TCAGAGAGAG TTGCTTTCAA 001440
001441 CCCTGGATAA TCAAACGACT TAGGGATAAA GCGCTTGCAC AAAAGAACCA CATAATGTTT TAAATACCTA AAGTTCTTTC 001520
001521 AAATCAAGAT TAAACAATGA CACTTTTGAC TGGATGCAAT GACTCATGCC CATAATCCCA GCACTTTGGG AGGCCGAGCC 001600
001601 GGGCAGGTCA TTTGAGGTTC GGAGTTCGAG ACCAGCCTGG GCAACATAAG CAAGACCCTG TCTCGAAAAA TAAAAATAAA 001680
001681 AAAGATACTC CTATTTGTCT ATACTGTGTA CTAAATGAGA AAAAAACTTT CAATATATTT GTGCTAAGTT TTTAAAGCCA 001760
001761 CATCAATTGG CTCAAAGTCC TTAATAAACA ATTAAGGTAT GAGAATAGTA TATAGATTTT AAAACCAGAT GTATAACATT 001840
001841 GTAATTTTAA AAAATATTTT AATGATCATC AGACATAATT TGCAATTTGA ATCCAACTCT GAACAAGAAC AAAAATGAAA 001920
001921 AAACCCATCT CTTAAACAGA GCTAGGCTAC TTTAAACACA GGAATAAGGC AAATGCCCTA CTCAGTAATG AGAAGCTCCT 002000
002001 CATGTAACTG TTTCTACAAC ATAGCTATCA CCAGGCCTGA ATTCTTTTGG GCTCAGAATT TGTTCTAAGA AATGGCTATT 002080
002081 ATTAAAAAGT CAAAAAATAA CAGATGCTGG CGAGCCTGTG GAGAAAAGGG AATGTATATA CATTTCTGGT GGGAATGTAA 002160
002161 ATTAGTTCAG CCATTGTAGA AAGTAGTTTG GTGATTTCTC AAATAACTTA AAACAGAATT ACCATTTGAC CTAGCAATCC 002240
002241 CATTACTGAG TATATACCCA AAGGAATATA AATTGTTCTA CCATAAAGTC ACATGCACAC ACATGTTCAG TGCTGTACTA 002320
002321 TTCACAATAG CAAAGACATG GAGTCAACCT ATATGCCCAT CAACGGTAGA CTGGATAAAG AAAATATGGT ACATATACAC 002400
002401 CATGGAATAC TACACAGCCA TAAAAAGAAT GAGCTTATGT CCTTTGCAGT AACACAGCTG AAGCAAACTA ACACAGGAAT 002480
002481 GGAAAACCAA ATACTGCATA TTCTCACTTA TAAGTGGGAG CTAAACATTG AGTACACATG GACACAAAGA AAGGAATAGA 002560
002561 CGCCTGGGGC GTATTTGAGG TTGGAGGTGA GAGGAGGGTG AGGATAGAAA AACTACCTAT CAGGTACTAT GCTTATTACC 002640
002641 TGGGTGATGA AATAATCTGT ACACCAAACT CCCAAGATAT GCAATGTACC TATACAACAA ACCTACAT