View source for MUC5B-AS1

''MUC5B-AS1'', MUC5B antisense RNA 1, a novel long non-coding antisense transcript for MUC5B.

==Annotated Information==
===Name===
''MUC5B-AS1'': MUC5B antisense RNA 1 [https://www.genenames.org/data/gene-symbol-report/#!/hgnc_id/HGNC:53936 (HGNC:53936)]

===Characteristics===
A single-strand antisense lncRNA that is transcribed from the negative strand of the MUC5B locus. MUC5B-AS1 is located at chromosomal 11p15.5, and composed of two exons with a full length of 434 nt. The sequence of MUC5B-AS1 was analyzed and three potential ORFs that might code peptides of 33–118 amino acids were identified. In order to confirm the non-coding nature of MUC5B-AS1, coding-potential analysis was performed by Coding Potential Assessment Tool (CPAT)23 and Coding Potential Calculator (CPC) computational algorithm, which predicted that MUC5B-AS1 had a very low coding potential. RNA fluorescence in situ hybridization (FISH) assay to examine the subcellular localization of MUC5B-AS1 revealed that MUC5B-AS1 was localized both in the nucleus and cytoplasm and predominantly in the cell cytoplasm. <ref name="ref1" />

===Function===
MUC5B-AS1 promotes cell migration and invasion by forming an RNA-RNA duplex with MUC5B, thereby increasing MUC5B expression levels in lung adenocarcinoma.<ref name="ref1" />

===Regulation===
MUC5B-AS1 and MUC5B are co-expressed and mutually regulate each other. <ref name="ref1" />

===Expression===
MUC5B-AS1 was upregulated in lung adenocarcinoma tissues compared with normal lung tissues. The high expression of MUC5B was significantly associated with poor outcomes in lung adenocarcinoma.<ref name="ref1" />

===Disease===
Lung adenocarcinoma <ref name="ref1" />

==Labs working on this lncRNA==
* Department of Epidemiology, College of Preventive Medicine, Army Medical University (Third Military Medical University), 400038 Chongqing, China
* Department of Pathology, Southwest Hospital, Army Medical University (Third Military Medical University), 400038 Chongqing, China
* Department of Thoracic Surgery, Xinqiao Hospital, Army Medical University (Third Military Medical University), 400038 Chongqing, China
* Department of Respiratory Disease, Xinqiao Hospital, Army Medical University (Third Military Medical University), 400038 Chongqing, China

==References==
<references>
<ref name="ref1"> Yuan S, Liu Q, Hu Z, Zhou Z, Wang G, Li C et al. Long non-coding RNA MUC5B-AS1 promotes metastasis through mutually regulating MUC5B expression in lung adenocarcinoma[J]. Cell death & disease. 2018, 9(5):450-450.</ref>(1)
</references>

==Sequence==
>gi|112577518|ref|NR_157183.1| Homo sapiens MUC5B antisense RNA 1 (MUC5B-AS1), long non-coding RNA
<dnaseq>TGGATCCAGTGGATGCAGTCGTAGTGGCTGTTGTGGTCAGCTCTGTGAGGATCCAGTGGACGCAGTCGTA
GTGGCTGTTGTGGTCGGCTTTGTGAGGATCCAGGTCGTCCCCGGAGTTGAGGAGGGCGTGGCCGTGGAGC
TGGTGGCTGGGGTACTGGGGCAGTGGCTGTAGTCGTCACAGCAAAGCACACGCACGTTGTAGTTGAAGCA
CATGTTGAACCTGCCTGTCTGGTCTTCGTTCTTGCAGGTCAGCCCCGTCTCCAGGCTGCAGGTCAGCACC
TGCCCGACCTGGTCGATGCTTACCTCGGGGTAGTTCTCCGCCCGGCACTCTATGCTCTTTGGTGCCCAGC
ACATCTTGCCCCCAGCAGCCCTGATGTTTTCAAAAGTTTCCATGTCCCCGCCTGCAACCCCTGAGGTTGG
GAAGTCCACGTCAA</dnaseq>