Difference between revisions of "LncRNAWiki:How to contribute"

From LncRNAWiki
Jump to: navigation, search
(Created page with "You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA. * If you are a researcher, please share your knowledge and curate genes...")
 
Line 1: Line 1:
{{basic|
+
You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.
tID = ENST00000590978.1|
+
* If you are a researcher, please share your knowledge and curate genes in your area of expertise.
same = |
+
* If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
location = chr19+:71161-72706|
+
* If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
classification = intergenic|
+
* If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
sequence = <dnaseq>GTGCACACGGCTCCCATGCGTTGTCTTCCGAGCGTCAGGCCGCCCCTACCCGTGCTTTCTGCTCTGCAGACCCTCTTCCTAGACCTCCGTCCTTTGTCCCATCGCTGCCTTCCCCTCAAGCTCAGGGCCAAGCTGTCCGCCAACCTCGGCTCCTCCGGGCAGCCCTCGCCCGGGGTGCGCCCCGGGGCAGGACCCCCAGCCCACGCCCAGGGCCCGCCCCTGCCCTCCAGCCCTACGCCTTGACCCGCTTTCCTGCGTCTCTCAGCCTACCTGACCTTGTCTTTACCTCTGTGGGCAGCTCCCTTGTGATCTGCTTAGTTCCCACCCCCCTTTAAGAATTCAATAGAGAAGCCAGACGCAAAACTACAGATATCGTATGAGTCCAGTTTTGTGAAGTGCCTAGAATAGTCAAAATTCACAGAGACAGAAGCAGTGGTCGCCAGGAATGGGGAAGCAAGGCGGAGTTGGGCAGCTCGTGTTCAATGGTTTTGTCCGCCTTCCCTGCCTCCTCTTCTGGGGGAGTTAGATCGAGTTGTAACAAGAACATGCCACTGTCTCGCTGGCTGCAGCGTGTGGTCCCCTTACCAGAGTGAGGATGCGAAGAGAAGGTGGCTGTCTGCAAACCAGGAAGAGAGCCCTCACCGGGAACCCGTCCAGCTGCCACCTTGAACTTGGACTTCCAAGCCTCCAGAACTGTGAGGGATAAATGTAT</dnaseq>|
+
* At the very least, please spread this news to any one who might be of interest.
}}
 
[[Category:Intergenic]]
 
 
 
{{annotation|
 
tID = ENST00000590978.1|
 
ann = <tab class=wikitable sep=tab head=top>
 
Source Type Begin End ID Classfication
 
HAVANA gene 71161 72719 ENSG00000267588.1 lincRNA
 
HAVANA transcript 71161 72706 ENST00000590978.1 lincRNA
 
HAVANA exon 71161 71646 NA NA
 
HAVANA exon 72171 72274 NA NA
 
HAVANA exon 72585 72706 NA NA
 
</tab>|
 
}}
 

Latest revision as of 14:41, 16 June 2014

You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.

  • If you are a researcher, please share your knowledge and curate genes in your area of expertise.
  • If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
  • If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
  • If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
  • At the very least, please spread this news to any one who might be of interest.