Difference between revisions of "LncRNAWiki:How to contribute"

From LncRNAWiki
Jump to: navigation, search
(Created page with "{{basic| tID = ENST00000440038.2| location = chr1+:317720-324873| same = | classification = intergenic| sequence = <dnaseq>GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACA...")
(Created page with "You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA. * If you are a researcher, please share your knowledge and curate genes...")
 
(6 intermediate revisions by one other user not shown)
Line 1: Line 1:
{{basic|
+
You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.
tID = ENST00000440038.2|
+
* If you are a researcher, please share your knowledge and curate genes in your area of expertise.
location = chr1+:317720-324873|
+
* If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
same = |
+
* If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
classification = intergenic|
+
* If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
sequence = <dnaseq>GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGGTCTCCCTCTGTTGTCCAAGGCTGGAGTGTAGTAGTGCTATCGCAGCTGACTGCAGCCTCAACCTTCCAGGCTGAAGCGATCCTCCCACCTCAACCTCCCACGTGGCTGAGACTACAGGTGCTTGCCACTATGCCCAACTAACATTTGGAATTTTCGTATACGTGGATTCCAGAGGGGTGACAGCGAAACGTGGGACCATCCAGTTGCAGGAAAACAAGCTTAACACGCCCACTAATTCTACATTATGCTCCTACCTCCCGGCAGCCTCTCCAGGCCCAGAACTTTCTCCAGTCAGCCTCTACAGACCAAGCTCATGACTCACAATGGCCTATTTAGGCCCATACCCTACGTCACGGCAGCCTCCGCAGATGAGGCTACTGCCTCACAACAGCCTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCTCTCCAGGCCCTGAACTTTCTCAAGTCGACCTCACCAGGCCCAGCTCATGCTTCTTTGCAGCCTCTCCAGGCCCAGCTCCTGCATCTTGGTGGCCCCTCCAGGCCCAGCCTCTGCCTCCCGTCGGCCTCTGCAGTCCCAACGTCTGCCTCACAGCAGATTCTTCACGCCCAGCATCTACCTCACTGTGGACCCCCCAAGCCAAGCTCCCAACCTTTCAGCAGCTT</dnaseq>|
+
* At the very least, please spread this news to any one who might be of interest.
}}
 

Latest revision as of 14:41, 16 June 2014

You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.

  • If you are a researcher, please share your knowledge and curate genes in your area of expertise.
  • If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
  • If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
  • If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
  • At the very least, please spread this news to any one who might be of interest.