Difference between revisions of "Lnc-SRA1-1:1"
(21 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
− | + | ''SRA1'' steroid receptor RNA activator 1 has been identified to activate steroid receptor transcriptional activity and participate in tumor pathogenesis. | |
− | |||
==Annotated Information== | ==Annotated Information== | ||
===Name=== | ===Name=== | ||
− | + | SRA1: Steroid receptor RNA activator 1 (HGNC nomenclature) | |
===Characteristics=== | ===Characteristics=== | ||
− | Bifunctional gene, active as an RNA and encodes a conserved protein SRAP <ref name="ref1" />. SRA has a large number of isoforms, most of which share a central core region. Only some isoforms are also able to encode the SRAP protein, and differential splicing may be one mechanism of generating coding and noncoding isoforms of SRA | + | [[File:sra1.jpg|right|thumb|400px|'''Secondary structure of human core ''SRA'' RNA'''<ref name="ref1" />]] |
+ | Bifunctional gene, active as an RNA and encodes a conserved protein SRAP <ref name="ref1" />. SRA has a large number of isoforms, most of which share a central core region. Only some isoforms are also able to encode the SRAP protein, and differential splicing may be one mechanism of generating coding and noncoding isoforms of SRA <ref name="ref1" /><ref name="ref2" />. A number of functional motifs, with predicted secondary structures, are required for SRA RNA function <ref name="ref3" />. | ||
===Function=== | ===Function=== | ||
− | Forms ribonucleoprotein complexes with a number of nuclear receptors (including many steroid hormone receptors) generally acting to stimulate transcriptional activation | + | Forms ribonucleoprotein complexes with a number of nuclear receptors (including many steroid hormone receptors) generally acting to stimulate transcriptional activation <ref name="ref1" /><ref name="ref4" />. Interacts either directly or through a complex with a number of other co-activator and repressor proteins, such as SRC-1, Sharp, SLIRP and p68 and p72 RNA helicases. SRA has been suggested to act as a scaffold for these complexes <ref name="ref1" />. Transgenic expression of SRA in vivo caused hyperplasia and morphological abnormalities in steroid hormone responsive tissues. Hyperplasia was accompanied by higher apoptosis however and expression of SRA did not lead to tumourigenesis <ref name="ref5" />. Associated with cardiomyopathy in humans, a role in heart development was validated in zebrafish but it's unclear if SRAP or SRA or both is responsible <ref name="ref6" />. SRA activity is regulated by pseudouridylation <ref name="ref7" /><ref name="ref8" />. |
+ | |||
+ | ''SRA'' interacts with ''SLIRP'' as a general corepressor for various nuclear receptors including VDR to suppress transcription and acts as co-activator in the Notch signalling pathway, which functions as a ‘tumor suppressor’ in mouse skin keratinocytes in that Notch1 ablation results in spontaneous and inducible skin cancer <ref name="ref15" />. | ||
+ | |||
+ | ''SRA'' deregulation contributes to the development of atherosclerosis through repressing the expression of adipose triglyceride lipase <ref name="ref14" />. | ||
+ | |||
+ | ''SRA'' promotes hepatic steatosis through repressing the expression of adipose triglyceride lipase (ATGL) <ref name="ref17" />. | ||
===Expression=== | ===Expression=== | ||
− | Expressed in a wide range of tissues, some isoforms appear to have tissue specific expression | + | Expressed in a wide range of tissues, some isoforms appear to have tissue specific expression <ref name="ref4" /><ref name="ref5" />. Up-regulated in tumours of steroid hormone responsive tissues ie: breast, uterus and ovary compared to matched normal tissue <ref name="ref5" /><ref name="ref9" />. Found in the nucleus and the cytoplasm <ref name="ref5" /><ref name="ref8" />. |
+ | {| class='wikitable' style="text-align:center" | ||
+ | |- | ||
+ | ! | Experiment | ||
+ | ! | Forward primer | ||
+ | ! | Reverse primer | ||
+ | |- | ||
+ | | rowspan="1"|RT-PCR | ||
+ | | | 5′-CAAGCGGAAGTGGAGATGGCGGAGC-3′ | ||
+ | | | 5′-GCGAAGTGTGTAGGGAGCGGAGGCG-3′<ref name="ref16" /> | ||
+ | |} | ||
===Conservation=== | ===Conservation=== | ||
− | SRA ncRNA conserved in mammals <ref name="ref1" />. SRAP Protein is conserved in chordata | + | SRA ncRNA conserved in mammals <ref name="ref1" />. SRAP Protein is conserved in chordata <ref name="ref10" />. |
===Misc=== | ===Misc=== | ||
− | Some isoforms of SRA encode a conserved protein product SRAP, which is also expressed in normal tissues and breast cancer | + | Some isoforms of SRA encode a conserved protein product SRAP, which is also expressed in normal tissues and breast cancer <ref name="ref10" /><ref name="ref11" /> <ref name="ref12" />. Studies show SRAP can also regulate the activity of nuclear receptors and bind to promoter regions regulated by nuclear receptors, suggesting functional similarities between SRA RNA and SRAP <ref name="ref1" /><ref name="ref13" />. |
− | |||
− | = | ||
− | |||
− | |||
− | |||
− | |||
+ | ===Disease=== | ||
+ | * Atherosclerosis <ref name="ref14" /> | ||
+ | * Breast cancer <ref name="ref1" /><ref name="ref16" /> | ||
+ | * Hepatic steatosis <ref name="ref17" /> | ||
+ | * Ovarian cancer <ref name="ref15" /> | ||
+ | * Uterus Cancer <ref name="ref15" /> | ||
==Labs working on this lncRNA== | ==Labs working on this lncRNA== | ||
− | + | * Department of Internal Medicine, The Central Hospital of Linyi, Linyi, Shandong 276400, P.R. China.<ref name="ref14" /> | |
+ | * Endocrine Research Unit (111N), Department of Medicine, VAMC/UCSF, NCIRE, San Francisco, CA, USA.<ref name="ref15" /> | ||
+ | * Department of Epidemiology and Statistics, College of Public Health, Zhengzhou University, Zhengzhou, 450001, PR China.<ref name="ref16" /> | ||
+ | * Department of Tumor Epidemiology, Henan Key Laboratory of Tumor Epidemiology, Zhengzhou, 450001, PR China.<ref name="ref16" /> | ||
+ | * Department of Hepatobiliary Surgery, The First Affiliated Hospital, Wenzhou Medical University, Wenzhou 325000, China.<ref name="ref17" /> | ||
+ | * Department of Pharmacology, School of Basic Medical Science, Nanjing Medical University, 140 Hanzhong Rd., Nanjing, Jiangsu, 210029, China.<ref name="ref17" /> | ||
+ | * Department of Chemical Biology, School of Pharmaceutical Sciences, Peking University, Beijing 100191, China.<ref name="ref17" /> | ||
+ | * Department of Internal Medicine, Division of Metabolism, Endocrinology and Diabetes, University of Michigan Medical Center, Ann Arbor, MI 48109-5678, USA.<ref name="ref17" /> | ||
==References== | ==References== | ||
Line 34: | Line 57: | ||
<ref name="ref1"> Leygue E. Steroid receptor RNA activator (SRA1): unusual bifaceted gene products with suspected relevance to breast cancer[J]. Nucl Recept Signal. 2007, 5(1):e006. | <ref name="ref1"> Leygue E. Steroid receptor RNA activator (SRA1): unusual bifaceted gene products with suspected relevance to breast cancer[J]. Nucl Recept Signal. 2007, 5(1):e006. | ||
</ref>(1) | </ref>(1) | ||
+ | <ref name="ref2"> Hube F, Guo J, Chooniedass-Kothari S, Cooper C, Hamedani MK, Dibrov AA et al. Alternative splicing of the first intron of the steroid receptor RNA activator (SRA) participates in the generation of coding and noncoding RNA isoforms in breast cancer cell lines[J]. DNA Cell Biol. 2006, 25(7):418-428. | ||
+ | </ref>(2) | ||
+ | <ref name="ref3"> Lanz RB, Razani B, Goldberg AD & O'Malley BW. Distinct RNA motifs are important for coactivation of steroid hormone receptors by steroid receptor RNA activator (SRA)[J]. Proc Natl Acad Sci U S A. 2002, 99(25):16081-16086. | ||
+ | </ref>(3) | ||
+ | <ref name="ref4"> Lanz RB, McKenna NJ, Onate SA, Albrecht U, Wong JM, Tsai SY et al. A steroid receptor coactivator, SRA, functions as an RNA and is present in an SRC-1 complex[J]. Cell. 1999, 97(1):17-27. | ||
+ | </ref>(4) | ||
+ | <ref name="ref5"> Lanz RB, Chua SS, Barron N, Soder BM, DeMayo F & O'Malley BW. Steroid receptor RNA activator stimulates proliferation as well as apoptosis in vivo[J]. Mol Cell Biol. 2003, 23(20):7163-7176. | ||
+ | </ref>(5) | ||
+ | <ref name="ref6"> Friedrichs F, Zugck C, Rauch GJ, Ivandic B, Weichenhan D, Muller-Bardorff M et al. HBEGF, SRA1, and IK: Three cosegregating genes as determinants of cardiomyopathy[J]. Genome Res. 2009, 19(3):395-403. | ||
+ | </ref>(6) | ||
+ | <ref name="ref7"> Zhao XS, Patton JR, Davis SL, Florence B, Ames SJ & Spanjaard RA. Regulation of nuclear receptor activity by a pseudouridine synthase through posttranscriptional modification of steroid receptor RNA activator[J]. Mol Cell. 2004, 15(4):549-558. | ||
+ | </ref>(7) | ||
+ | <ref name="ref8"> Zhao XS, Patton JR, Ghosh SK, Fischel-Ghodsian N, Shen L & Spanjaard RA. Pus3p-and pus1p-dependent pseudouridylation of steroid receptor RNA activator controls a functional switch that regulates nuclear receptor signaling[J]. Mol Endocrinol. 2007, 21(3):686-699. | ||
+ | </ref>(8) | ||
+ | <ref name="ref9"> Murphy LC, Simon SLR, Parkes A, Leygue E, Dotzlaw H, Snell L et al. Altered expression of estrogen receptor coregulators during human breast tumorigenesis[J]. Cancer Research. 2000, 60(22):6266-6271. | ||
+ | </ref>(9) | ||
+ | <ref name="ref10"> Chooniedass-Kothari S, Emberley E, Hamedani MK, Troup S, Wang X, Czosnek A et al. The steroid receptor RNA activator is the first functional RNA encoding a protein[J]. Febs Lett. 2004, 566(1-3):43-47. | ||
+ | </ref>(10) | ||
+ | <ref name="ref11"> Emberley E, Huang GJ, Hamedani MK, Czosnek A, Ali D, Grolla A et al. Identification of new human coding steroid receptor RNA activator isoforms[J]. Biochemical and biophysical research communications. 2003, 301(2):509-515. | ||
+ | </ref>(11) | ||
+ | <ref name="ref12"> Chooniedass-Kothari S, Hamedani MK, Troup S, Hube F & Leygue E. The steroid receptor RNA activator protein is expressed in breast tumor tissues[J]. International Journal of Cancer. 2006, 118(4):1054-1059. | ||
+ | </ref>(12) | ||
+ | <ref name="ref13"> Chooniedass-Kothari S, Hamedani MK, Auge C, Wang XM, Carascossa S, Yan Y et al. The steroid receptor RNA activator protein is recruited to promoter regions and acts as a transcriptional repressor[J]. Febs Lett. 2010, 584(11):2218-2224. | ||
+ | </ref>(13) | ||
+ | <ref name="ref14"> Yang S, Sun J. LncRNA SRA deregulation contributes to the development of atherosclerosis by causing dysfunction of endothelial cells through repressing the expression of adipose triglyceride lipase[J]. Molecular medicine reports, 2018, 18(6): 5207-5214. | ||
+ | </ref>(14) | ||
+ | <ref name="ref15"> Jiang Y J, Bikle D D. Lnc RNA: a new player in 1α, 25 (OH) 2 vitamin D3/VDR protection against skin cancer formation[J]. Experimental dermatology, 2014, 23(3): 147-150. | ||
+ | </ref>(15) | ||
+ | <ref name="ref16"> Yan R, Wang KJ, Peng R, Wang SB, Cao JJ, Wang P et al. Genetic variants in lncRNA SRA and risk of breast cancer[J]. Oncotarget. 2016, 7(16):22486-22496. | ||
+ | </ref>(16) | ||
+ | <ref name="ref17"> Chen G, Yu D, Nian X, Liu J, Koenig RJ, Xu B et al. LncRNA SRA promotes hepatic steatosis through repressing the expression of adipose triglyceride lipase (ATGL)[J]. Scientific reports.2016, 6:35531. | ||
+ | </ref>(17) | ||
</references> | </references> | ||
− | + | ===sequence=== | |
− | + | >gi|10011|ref|NM_001035235.2| Homo sapiens steroid receptor RNA activator 1 (SRA1)<dnaseq>GCAGGCACTAAGCTGGGCACTGGGAATGTAATAAAATAGTCAAGGTCCCACCTTCTAAGACTGTCCGACA | |
− | + | GGGAAACGAACAAGAGTCAAATAAGGCAGAAGATGTGATGTAATACACCTACGAAATCTCAGAGGGTTGT | |
− | + | AGGGTCGTGGGAGCTCAAGTGAGACACTTAACCTGGCCTGAGACATTCCAGAAGGCCTCCTGAAGAACTG | |
− | + | ACATCTGAACTGAGAACTGAAGGAAGATGAGTACTAGTGAGGCTACCGGACGTGAATGTGGAGATTGTGC | |
− | + | AGGGCAATGCAAGAGGAGGCTGTAGAAGTCAACCTGGCTAGATCACAGCGGGGTGTATGTGGGGCAGGAG | |
− | + | CTTCTTTGTTTGAATTTGCTCCTGAGAGGATGAGGCCTCCTAGAGCACTGGCTCCTGGACAGCAACCTCC | |
− | + | TTTGGTGCCTTGTGACCAGGGCCCTGATGGTTCATTAGATGGAGCCTTCGAGTCTTAGGGAGTTGCCGCA | |
− | + | GGGTCCCCACAGCGGCTCCCGACGGTTGTGAACCAGCATCCATCCTCCACGGATTCCGGCAACCCGCCTG | |
− | + | GCCCTGGACGTGTCTCAACTGGCCCGCGTGAGGGGCCGCCCCGGAAATGACGCGCTGCCCCGCTGGCCAA | |
− | + | GCGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAGGAACGCGGCTGGAACGACCCGCCGC | |
− | + | AGTTCTCATACGGGCTGCAGACCCAGGCCGGCGGACCCAGGCGCTCGCTGCTTACCAAGAGGGTCGCCGC | |
− | + | ACCCCAGGATGGATCCCCCAGAGTCCCCGCATCAGAGACTTCTCCTGGGCCTCCCCCAATGGGGCCTCCA | |
− | + | CCTCCTTCAAGTAAGGCTCCCAGGTCCCCACCTGTGGGGAGTGGTCCTGCCTCTGGCGTGGAGCCCACAA | |
+ | GTTTCCCAGTCGAGTCTGAGGCTGTGATGGAGGATGTGCTGAGACCTTTGGAACAGGCATTGGAAGACTG | ||
+ | CCGTGGCCACACAAGGAAGCAGGTATGTGATGACATCAGCCGACGCCTGGCACTGCTGCAGGAACAGTGG | ||
+ | GCTGGAGGAAAGTTGTCAATACCTGTAAAGAAGAGAATGGCTCTACTGGTGCAAGAGCTTTCAAGCCACC | ||
+ | GGTGGGACGCAGCAGATGACATCCACCGCTCCCTCATGGTTGACCATGTGACTGAGGTCAGTCAGTGGAT | ||
+ | GGTAGGAGTTAAAAGATTAATTGCAGAAAAGAGGAGTCTGTTTTCAGAGGAGGCAGCCAATGAAGAGAAA | ||
+ | TCTGCAGCCACAGCTGAGAAGAACCATACCATACCAGGCTTCCAGCAGGCTTCATAATCCTCGGTTCCCC | ||
+ | AGACTCACCGGACACCATCTCCTATGCCTTGGAGACCTTCTGTCACTTGGCTCCCTTCTTACCACCACCA | ||
+ | AGACTGTCCCACTGGGCCTGACCCACCTATGAGGGAAGAAGTCCCACCTGGGCCAGAGGGAGTTCATGTG | ||
+ | TTACTCATAACATGCATTTCAATAAAAACATCTCTGCGGTGGGCCTTGGGTAGGAGAGATGAACCCTTCC | ||
+ | GGTGCCAAGCTAGTCCCCTCTGGTGTCCTCGACTGCCCTGCTCCCTGTGTATCTGCAAACCTCTGTTCTC | ||
+ | CCTTCTCCATTCATCAGGAAGGGATCTGCTGGGTAAAGTCAGACTACTGCCTACCACTTTTTCCCAAAGT | ||
+ | AGACTGAAAGCACATCCTGTGCTGGGCGGAGCAGCTGTGTTTGGATGGTTTCATTTCAGCATGAGAACAG | ||
+ | ACTCAAATAGAACGGGGAGACTTTTCCCTCAACAAAAGGAAAGACAGTCCTATTTGCACTGTATCACCCT | ||
+ | TGAGATACTACTGTTACAGAGATTAGAACCACATTGAGTGGGGTTTTCTGTGTAAATCGAAGGAGAAAAA | ||
+ | GACCAGATTACTGAGATTGGGGATTGTAACTCTGACTTGCCAAACAAACTGCTGCCTCAAAAAAAAAAAA | ||
+ | AAAAA | ||
+ | </dnaseq> |
Latest revision as of 06:28, 19 November 2018
SRA1 steroid receptor RNA activator 1 has been identified to activate steroid receptor transcriptional activity and participate in tumor pathogenesis.
Contents
Annotated Information
Name
SRA1: Steroid receptor RNA activator 1 (HGNC nomenclature)
Characteristics
Bifunctional gene, active as an RNA and encodes a conserved protein SRAP [1]. SRA has a large number of isoforms, most of which share a central core region. Only some isoforms are also able to encode the SRAP protein, and differential splicing may be one mechanism of generating coding and noncoding isoforms of SRA [1][2]. A number of functional motifs, with predicted secondary structures, are required for SRA RNA function [3].
Function
Forms ribonucleoprotein complexes with a number of nuclear receptors (including many steroid hormone receptors) generally acting to stimulate transcriptional activation [1][4]. Interacts either directly or through a complex with a number of other co-activator and repressor proteins, such as SRC-1, Sharp, SLIRP and p68 and p72 RNA helicases. SRA has been suggested to act as a scaffold for these complexes [1]. Transgenic expression of SRA in vivo caused hyperplasia and morphological abnormalities in steroid hormone responsive tissues. Hyperplasia was accompanied by higher apoptosis however and expression of SRA did not lead to tumourigenesis [5]. Associated with cardiomyopathy in humans, a role in heart development was validated in zebrafish but it's unclear if SRAP or SRA or both is responsible [6]. SRA activity is regulated by pseudouridylation [7][8].
SRA interacts with SLIRP as a general corepressor for various nuclear receptors including VDR to suppress transcription and acts as co-activator in the Notch signalling pathway, which functions as a ‘tumor suppressor’ in mouse skin keratinocytes in that Notch1 ablation results in spontaneous and inducible skin cancer [9].
SRA deregulation contributes to the development of atherosclerosis through repressing the expression of adipose triglyceride lipase [10].
SRA promotes hepatic steatosis through repressing the expression of adipose triglyceride lipase (ATGL) [11].
Expression
Expressed in a wide range of tissues, some isoforms appear to have tissue specific expression [4][5]. Up-regulated in tumours of steroid hormone responsive tissues ie: breast, uterus and ovary compared to matched normal tissue [5][12]. Found in the nucleus and the cytoplasm [5][8].
Experiment | Forward primer | Reverse primer |
---|---|---|
RT-PCR | 5′-CAAGCGGAAGTGGAGATGGCGGAGC-3′ | 5′-GCGAAGTGTGTAGGGAGCGGAGGCG-3′[13] |
Conservation
SRA ncRNA conserved in mammals [1]. SRAP Protein is conserved in chordata [14].
Misc
Some isoforms of SRA encode a conserved protein product SRAP, which is also expressed in normal tissues and breast cancer [14][15] [16]. Studies show SRAP can also regulate the activity of nuclear receptors and bind to promoter regions regulated by nuclear receptors, suggesting functional similarities between SRA RNA and SRAP [1][17].
Disease
- Atherosclerosis [10]
- Breast cancer [1][13]
- Hepatic steatosis [11]
- Ovarian cancer [9]
- Uterus Cancer [9]
Labs working on this lncRNA
- Department of Internal Medicine, The Central Hospital of Linyi, Linyi, Shandong 276400, P.R. China.[10]
- Endocrine Research Unit (111N), Department of Medicine, VAMC/UCSF, NCIRE, San Francisco, CA, USA.[9]
- Department of Epidemiology and Statistics, College of Public Health, Zhengzhou University, Zhengzhou, 450001, PR China.[13]
- Department of Tumor Epidemiology, Henan Key Laboratory of Tumor Epidemiology, Zhengzhou, 450001, PR China.[13]
- Department of Hepatobiliary Surgery, The First Affiliated Hospital, Wenzhou Medical University, Wenzhou 325000, China.[11]
- Department of Pharmacology, School of Basic Medical Science, Nanjing Medical University, 140 Hanzhong Rd., Nanjing, Jiangsu, 210029, China.[11]
- Department of Chemical Biology, School of Pharmaceutical Sciences, Peking University, Beijing 100191, China.[11]
- Department of Internal Medicine, Division of Metabolism, Endocrinology and Diabetes, University of Michigan Medical Center, Ann Arbor, MI 48109-5678, USA.[11]
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Leygue E. Steroid receptor RNA activator (SRA1): unusual bifaceted gene products with suspected relevance to breast cancer[J]. Nucl Recept Signal. 2007, 5(1):e006.
- ↑ Hube F, Guo J, Chooniedass-Kothari S, Cooper C, Hamedani MK, Dibrov AA et al. Alternative splicing of the first intron of the steroid receptor RNA activator (SRA) participates in the generation of coding and noncoding RNA isoforms in breast cancer cell lines[J]. DNA Cell Biol. 2006, 25(7):418-428.
- ↑ Lanz RB, Razani B, Goldberg AD & O'Malley BW. Distinct RNA motifs are important for coactivation of steroid hormone receptors by steroid receptor RNA activator (SRA)[J]. Proc Natl Acad Sci U S A. 2002, 99(25):16081-16086.
- ↑ 4.0 4.1 Lanz RB, McKenna NJ, Onate SA, Albrecht U, Wong JM, Tsai SY et al. A steroid receptor coactivator, SRA, functions as an RNA and is present in an SRC-1 complex[J]. Cell. 1999, 97(1):17-27.
- ↑ 5.0 5.1 5.2 5.3 Lanz RB, Chua SS, Barron N, Soder BM, DeMayo F & O'Malley BW. Steroid receptor RNA activator stimulates proliferation as well as apoptosis in vivo[J]. Mol Cell Biol. 2003, 23(20):7163-7176.
- ↑ Friedrichs F, Zugck C, Rauch GJ, Ivandic B, Weichenhan D, Muller-Bardorff M et al. HBEGF, SRA1, and IK: Three cosegregating genes as determinants of cardiomyopathy[J]. Genome Res. 2009, 19(3):395-403.
- ↑ Zhao XS, Patton JR, Davis SL, Florence B, Ames SJ & Spanjaard RA. Regulation of nuclear receptor activity by a pseudouridine synthase through posttranscriptional modification of steroid receptor RNA activator[J]. Mol Cell. 2004, 15(4):549-558.
- ↑ 8.0 8.1 Zhao XS, Patton JR, Ghosh SK, Fischel-Ghodsian N, Shen L & Spanjaard RA. Pus3p-and pus1p-dependent pseudouridylation of steroid receptor RNA activator controls a functional switch that regulates nuclear receptor signaling[J]. Mol Endocrinol. 2007, 21(3):686-699.
- ↑ 9.0 9.1 9.2 9.3 Jiang Y J, Bikle D D. Lnc RNA: a new player in 1α, 25 (OH) 2 vitamin D3/VDR protection against skin cancer formation[J]. Experimental dermatology, 2014, 23(3): 147-150.
- ↑ 10.0 10.1 10.2 Yang S, Sun J. LncRNA SRA deregulation contributes to the development of atherosclerosis by causing dysfunction of endothelial cells through repressing the expression of adipose triglyceride lipase[J]. Molecular medicine reports, 2018, 18(6): 5207-5214.
- ↑ 11.0 11.1 11.2 11.3 11.4 11.5 Chen G, Yu D, Nian X, Liu J, Koenig RJ, Xu B et al. LncRNA SRA promotes hepatic steatosis through repressing the expression of adipose triglyceride lipase (ATGL)[J]. Scientific reports.2016, 6:35531.
- ↑ Murphy LC, Simon SLR, Parkes A, Leygue E, Dotzlaw H, Snell L et al. Altered expression of estrogen receptor coregulators during human breast tumorigenesis[J]. Cancer Research. 2000, 60(22):6266-6271.
- ↑ 13.0 13.1 13.2 13.3 Yan R, Wang KJ, Peng R, Wang SB, Cao JJ, Wang P et al. Genetic variants in lncRNA SRA and risk of breast cancer[J]. Oncotarget. 2016, 7(16):22486-22496.
- ↑ 14.0 14.1 Chooniedass-Kothari S, Emberley E, Hamedani MK, Troup S, Wang X, Czosnek A et al. The steroid receptor RNA activator is the first functional RNA encoding a protein[J]. Febs Lett. 2004, 566(1-3):43-47.
- ↑ Emberley E, Huang GJ, Hamedani MK, Czosnek A, Ali D, Grolla A et al. Identification of new human coding steroid receptor RNA activator isoforms[J]. Biochemical and biophysical research communications. 2003, 301(2):509-515.
- ↑ Chooniedass-Kothari S, Hamedani MK, Troup S, Hube F & Leygue E. The steroid receptor RNA activator protein is expressed in breast tumor tissues[J]. International Journal of Cancer. 2006, 118(4):1054-1059.
- ↑ Chooniedass-Kothari S, Hamedani MK, Auge C, Wang XM, Carascossa S, Yan Y et al. The steroid receptor RNA activator protein is recruited to promoter regions and acts as a transcriptional repressor[J]. Febs Lett. 2010, 584(11):2218-2224.
sequence
>gi|10011|ref|NM_001035235.2| Homo sapiens steroid receptor RNA activator 1 (SRA1)000081 CAAGAGTCAA ATAAGGCAGA AGATGTGATG TAATACACCT ACGAAATCTC AGAGGGTTGT AGGGTCGTGG GAGCTCAAGT 000160
000161 GAGACACTTA ACCTGGCCTG AGACATTCCA GAAGGCCTCC TGAAGAACTG ACATCTGAAC TGAGAACTGA AGGAAGATGA 000240
000241 GTACTAGTGA GGCTACCGGA CGTGAATGTG GAGATTGTGC AGGGCAATGC AAGAGGAGGC TGTAGAAGTC AACCTGGCTA 000320
000321 GATCACAGCG GGGTGTATGT GGGGCAGGAG CTTCTTTGTT TGAATTTGCT CCTGAGAGGA TGAGGCCTCC TAGAGCACTG 000400
000401 GCTCCTGGAC AGCAACCTCC TTTGGTGCCT TGTGACCAGG GC