http://192.168.164.12:8010/index.php?title=Lnc-EPCAM-1:2&feed=atom&action=history
Lnc-EPCAM-1:2 - Revision history
2024-03-28T23:17:13Z
Revision history for this page on the wiki
MediaWiki 1.30.0
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1276473&oldid=prev
Qianpeng Li at 01:54, 13 August 2019
2019-08-13T01:54:13Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 01:54, 13 August 2019</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l52" >Line 52:</td>
<td colspan="2" class="diff-lineno">Line 52:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Stomach cancer <ref name="ref3" /></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Stomach cancer <ref name="ref3" /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Tongue cancer <ref name="ref3" /></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Tongue cancer <ref name="ref3" /></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">===Sequence===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"><dnaseq>GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGA</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">GCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACCCCGTTCTCCAGAAAAAGGAAAAAAAAAAA</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">CAAAAGACAAAAAAAAAATAAGCGTAACTTCCCTCAAAGCAACAACCCCCCCCCCCCTTT</dnaseq></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Labs working on this lncRNA==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Labs working on this lncRNA==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l86" >Line 86:</td>
<td colspan="2" class="diff-lineno">Line 90:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></ref>(11)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></ref>(11)</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></references></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></references></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">===Sequence===</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"><dnaseq>GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGA</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">GCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACCCCGTTCTCCAGAAAAAGGAAAAAAAAAAA</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CAAAAGACAAAAAAAAAATAAGCGTAACTTCCCTCAAAGCAACAACCCCCCCCCCCCTTT</dnaseq></del></div></td><td colspan="2"> </td></tr>
</table>
Qianpeng Li
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1276026&oldid=prev
Qianpeng Li at 03:37, 31 July 2019
2019-07-31T03:37:34Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 03:37, 31 July 2019</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l2" >Line 2:</td>
<td colspan="2" class="diff-lineno">Line 2:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Annotated Information==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Annotated Information==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">===</del>Approved <del class="diffchange diffchange-inline">Symbol===</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Approved <ins class="diffchange diffchange-inline">symbol: </ins>''BCYRN1''</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1''</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">===Name===</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">Approved name: </ins>''BCYRN1'' : brain cytoplasmic RNA 1</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'': brain cytoplasmic RNA 1 <del class="diffchange diffchange-inline"><ref name="ref1" /><ref name="ref2" /></del>,</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">BC200 <ref name="ref1" /><ref name="ref2" /></del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">Alias symbols: BC200, BC200a, NCRNA00004</ins>, <ins class="diffchange diffchange-inline">LINC00004</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">HGNC ID : HGNC:1022</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">RefSeq ID: NR_001568</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">LncBook ID: HSALNT0289486</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Characteristics===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Characteristics===</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l32" >Line 32:</td>
<td colspan="2" class="diff-lineno">Line 38:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity  <ref name="ref3" />.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity  <ref name="ref3" />.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" />.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" />.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">===Evolution===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">''BCYRN1'' arose after ''Anthropoidea'' diverged from prosimians and is conserved in ''Anthropoidea''<ref name="ref11" />.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Disease===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Disease===</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l75" >Line 75:</td>
<td colspan="2" class="diff-lineno">Line 83:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><ref name="ref10">  Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><ref name="ref10">  Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></ref>(10)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></ref>(10)</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"><ref name="ref11">  Kuryshev V Y , Skryabin B V , Kremerskothen J , et al. Birth of a gene: locus of neuronal BC200 snmRNA in three prosimians and human BC200 pseudogenes as archives of change in the Anthropoidea lineage[J]. Journal of Molecular Biology, 2001, 309(5):0-1066.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ref>(11)</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></references></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></references></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Qianpeng Li
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1275293&oldid=prev
Huma at 05:12, 15 November 2018
2018-11-15T05:12:12Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 05:12, 15 November 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l18" >Line 18:</td>
<td colspan="2" class="diff-lineno">Line 18:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Function===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Function===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is important in several key features of cancer – like cell proliferation, survival and migration <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is important in several key features of cancer – like cell proliferation, survival and migration <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' may act as a linker between certain proteins and mRNAs, allowing transient regulation and/or modification <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' may act as a linker between certain proteins and mRNAs, allowing transient regulation and/or modification <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' exerts its translational inhibitory effects by acting as a competitor for PABP <ref name="ref9" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' exerts its translational inhibitory effects by acting as a competitor for PABP <ref name="ref9" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1''and BC1 interfere with eIF4A's catalytic mechanism by blocking the factor's helicase activity, while enhancing its ATPase activity <ref name="ref10" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1''and BC1 interfere with eIF4A's catalytic mechanism by blocking the factor's helicase activity, while enhancing its ATPase activity <ref name="ref10" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is linked wit necrosis <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is linked wit necrosis <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Regulation===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Regulation===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>TATA box and internal promoter elements play a critical role in transcription of ''BCYRN1'' <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>TATA box and internal promoter elements play a critical role in transcription of ''BCYRN1'' <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Expression===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Expression===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>long noncoding RNA ''BCYRN1'' is expressed predominantly in different regions of the brain. It also shows low level expression in testis but not in other normal tissues examined  <ref name="ref3" /> <ref name="ref7" />  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>long noncoding RNA ''BCYRN1'' is expressed predominantly in different regions of the brain. It also shows low level expression in testis but not in other normal tissues examined  <ref name="ref3" /> <ref name="ref7" /><ins class="diffchange diffchange-inline">. </ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is disregulated in cancer and is expressed in a number of human tumours but not in corresponding normal  <ref name="ref3" />  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is disregulated in cancer and is expressed in a number of human tumours but not in corresponding normal  <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity  <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity  <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Disease===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Disease===</div></td></tr>
</table>
Huma
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1275292&oldid=prev
Huma: /* Name */
2018-11-15T05:10:41Z
<p><span dir="auto"><span class="autocomment">Name</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 05:10, 15 November 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l5" >Line 5:</td>
<td colspan="2" class="diff-lineno">Line 5:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1''</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1''</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Name===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Name===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'': brain cytoplasmic RNA 1 <ref name="ref1" /><ref name="ref2" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'': brain cytoplasmic RNA 1 <ref name="ref1" /><ref name="ref2" /><ins class="diffchange diffchange-inline">,</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>BC200 <ref name="ref1" /><ref name="ref2" /></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>BC200 <ref name="ref1" /><ref name="ref2" /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Huma
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1275291&oldid=prev
Huma: /* Characteristics */
2018-11-15T05:10:05Z
<p><span dir="auto"><span class="autocomment">Characteristics</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 05:10, 15 November 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l9" >Line 9:</td>
<td colspan="2" class="diff-lineno">Line 9:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Characteristics===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Characteristics===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is a shortest known long noncoding RNA with a length of 200bps <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is a shortest known long noncoding RNA with a length of 200bps<ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is sense-transcribed from its gene locus situated on human chromosome 2 between the protein-coding genes for calmodulin 2 (CALM2) and epithelial cellular adhesion molecule (EPCAM)<ref name="ref1" /><ref name="ref2" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is sense-transcribed from its gene locus situated on human chromosome 2 between the protein-coding genes for calmodulin 2 (CALM2) and epithelial cellular adhesion molecule (EPCAM)<ref name="ref1" /><ref name="ref2" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is relatively recent, no orthologs of ''BCYRN1'' have been identified outside of the primate order <ref name="ref8" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is relatively recent, no orthologs of ''BCYRN1'' have been identified outside of the primate order <ref name="ref8" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is found in the primate brain, Among neural cells, ''BCYRN1'' is highly expressed in dendrites, where is it thought to play a role in local translational control <ref name="ref3" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is found in the primate brain, Among neural cells, ''BCYRN1'' is highly expressed in dendrites, where is it thought to play a role in local translational control <ref name="ref3" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is a tissue-specific Pol III transcript, altering the view that Pol III was only responsible for the synthesis of transfer RNA (tRNA) and 5 S ribosomal RNA <ref name="ref4" /><ref name="ref5" /><ref name="ref6" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' is a tissue-specific Pol III transcript, altering the view that Pol III was only responsible for the synthesis of transfer RNA (tRNA) and 5 S ribosomal RNA <ref name="ref4" /><ref name="ref5" /><ref name="ref6" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' RNA sequence revealed three distinct sequence domains: a 5′ Alu element, a central adenosine-rich region and a 3′, 43-nucleotide, unique region containing a cytosine-rich stretch <ref name="ref7" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' RNA sequence revealed three distinct sequence domains: a 5′ Alu element, a central adenosine-rich region and a 3′, 43-nucleotide, unique region containing a cytosine-rich stretch <ref name="ref7" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' has a 5′ Alu element that has very high sequence homology to the Alu-J repetitive element found in the human genome and the Alu domain of 7SL RNA <ref name="ref7" /></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>''BCYRN1'' has a 5′ Alu element that has very high sequence homology to the Alu-J repetitive element found in the human genome and the Alu domain of 7SL RNA <ref name="ref7" /><ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Function===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Function===</div></td></tr>
</table>
Huma
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1275290&oldid=prev
Huma at 05:07, 15 November 2018
2018-11-15T05:07:50Z
<p></p>
<a href="https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1275290&oldid=1274218">Show changes</a>
Huma
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1274218&oldid=prev
Lin Liu at 08:59, 27 March 2018
2018-03-27T08:59:27Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 08:59, 27 March 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l38" >Line 38:</td>
<td colspan="2" class="diff-lineno">Line 38:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Labs working on this lncRNA==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Labs working on this lncRNA==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">Please input related labs here</del>.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">* The Robert F</ins>. <ins class="diffchange diffchange-inline">Furchgott Center for Neural and Behavioral Science, Department of Physiology and Pharmacology, State University of New York Health Science Center, Brooklyn, NY 11203, USA. [http://www.ncbi.nlm.nih.gov/pubmed/17553964 (Mus (2007))]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==References==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==References==</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">==References==</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"><references></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"><ref name="ref1"> Mus E, Hof PR, Tiedge H. Dendritic BC200 RNA in aging and in Alzheimer's</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">disease. Proc Natl Acad Sci U S A. 2007 Jun 19;104(25):10679-84.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ref>(1)</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></references></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[http://www.lncrnadb.org/BC200/ Annotation originally sourced from lncRNAdb.]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[http://www.lncrnadb.org/BC200/ Annotation originally sourced from lncRNAdb.]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Lin Liu
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1274217&oldid=prev
Lin Liu at 08:58, 27 March 2018
2018-03-27T08:58:09Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 08:58, 27 March 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l30" >Line 30:</td>
<td colspan="2" class="diff-lineno">Line 30:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Disease===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Disease===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Alzheimer's disease</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Alzheimer's disease <ins class="diffchange diffchange-inline">[http://www.ncbi.nlm.nih.gov/pubmed/17553964 (Mus (2007))]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Evolution===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Evolution===</div></td></tr>
</table>
Lin Liu
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1274216&oldid=prev
Lin Liu at 08:57, 27 March 2018
2018-03-27T08:57:27Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 08:57, 27 March 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l28" >Line 28:</td>
<td colspan="2" class="diff-lineno">Line 28:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Allelic Information and Variation===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Allelic Information and Variation===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Please input allelic information and variation information here.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Please input allelic information and variation information here.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">===Disease===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">Alzheimer's disease</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Evolution===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Evolution===</div></td></tr>
</table>
Lin Liu
https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&diff=1274215&oldid=prev
Lin Liu at 08:54, 27 March 2018
2018-03-27T08:54:30Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 08:54, 27 March 2018</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l8" >Line 8:</td>
<td colspan="2" class="diff-lineno">Line 8:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Characteristics===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Characteristics===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>200 nucleotide ncRNA [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))] exapted from an Alu element [http://www.ncbi.nlm.nih.gov/pubmed/2444875 (Watson (1987))]. Transcribed by RNA polymerase III [http://www.ncbi.nlm.nih.gov/pubmed/8265590 (Martignetti (1993))]. Three structural domains, 5' that shares homology with Alu elements, a central A rich region and a 3' unique region [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))].  </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>200 nucleotide ncRNA [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))] exapted from an Alu element [http://www.ncbi.nlm.nih.gov/pubmed/2444875 (Watson (1987))]. Transcribed by RNA polymerase III [http://www.ncbi.nlm.nih.gov/pubmed/8265590 (Martignetti (1993))]. Three structural domains, 5' that shares homology with Alu elements, a central A rich region and a 3' unique region [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))].  </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">===Transcriptomic Nomeclature===</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">Please input transcriptomic nomeclature information here.</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Function===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Function===</div></td></tr>
</table>
Lin Liu