Difference between revisions of "LINC00574"

From LncRNAWiki
Jump to: navigation, search
(Created page with "''LINC00574'' is a lincRNA that is associated with chemoresistance in primary breast cancer. ==Annotated Information== ===Name=== Approved symbol: ''LINC00574'' Approved name...")
Line 41: Line 41:
==Labs working on this lncRNA==
* Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China.
* Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China.
<ref name="ref1">
Li Y , Wang B , Lai H , et al. Long non-coding RNA CRALA is associated with poor response to chemotherapy in primary breast cancer[J]. Thoracic Cancer, 2017.
NR_026780.1 Homo sapiens long intergenic non-protein coding RNA 574 (LINC00574), long non-coding RNA<dnaseq>GTGCTTGACTGGAGGAGGGCTGGCAGCAGAAGTGCAGCTGACCGGGTTGCGTTTTCGTACGGCTGACTAA
Line 91: Line 79:
==Labs working on this lncRNA==
* Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China.
* Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China.
<ref name="ref1">
Li Y , Wang B , Lai H , et al. Long non-coding RNA CRALA is associated with poor response to chemotherapy in primary breast cancer[J]. Thoracic Cancer, 2017.

Latest revision as of 01:52, 13 August 2019

LINC00574 is a lincRNA that is associated with chemoresistance in primary breast cancer.

Annotated Information


Approved symbol: LINC00574

Approved name: long intergenic non-protein coding RNA 574.

Previous symbols: C6orf208.

Alias symbols: FLJ13162, dJ182D15.1, CRALA.


RefSeq ID: NR_026780



LINC00574 silencing in chemoresistant breast cancer cells resensitizes cells to chemotherapy[1].
  • LINC00574 might be a target to reverse chemoresistance in breast cancer patients.[1].



Primary breast cancer[1].


Non-responding tumors (poor response to chemotherapy, 32 samples) had fourfold higher LINC00574 expression than responding tumors (good response to chemotherapy, 47 samples). LINC00574 is upregulated in chemoresistant breast cancer cell lines compared to their parental lines[1].

Experiment Forward primer Reverse primer



>NR_026780.1 Homo sapiens long intergenic non-protein coding RNA 574 (LINC00574), long non-coding RNA
002561 AAAAAG

Labs working on this lncRNA

  • Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China.
  • Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China.


  1. 1.0 1.1 1.2 1.3 1.4 Li Y , Wang B , Lai H , et al. Long non-coding RNA CRALA is associated with poor response to chemotherapy in primary breast cancer[J]. Thoracic Cancer, 2017.