Difference between revisions of "IL1R1-AS1"

From LncRNAWiki
Jump to: navigation, search
(Created page with "''IL1R1-AS1'', IL1R1 antisense RNA 1 is a long non-coding RNA that could be a novel circulating biomarker for the determination of oral squamous cell carcinoma (OSCC). ==Anno...")
 
(Sequence)
 
Line 34: Line 34:
  
 
==Sequence==
 
==Sequence==
 +
>ENST00000428188.1 Homo sapiens lncRNA IL1R1-AS1 cDNA
 +
<dnaseq>GGTAAATTAATCTCTCAACTGGTTGAACACAGCTTTAGAGATGTCAACAGCCTCCTATGA
 +
GTCTAGAGTCAGGTGGTACAGGCTCAACTGGTCTAACAGCTGCAAATTTTGAGAGACTGC
 +
TGTGCTAATGTTTGGGGCTCAGATTTAAGGTATAGGTATGATTTACGTACTTTGAGCAGC
 +
CAAGCCTTCTTCAGAAGAAACCTGAGCGGCATGTGCTCCTCCCCACCTGCTTCCCCACAA
 +
CAGGAAGAACTCTCTGCAGAAGGTCTCCTCACCTTGTTGAGGCCTGGGAATGTGCAAATG
 +
TGCAGGATTTTCCACACTATTCGAGAGAGAGAGTAAATAAACTTGTGTAAGTTAATTGCA
 +
TCAACTACAAATAAGACCTGTA</dnaseq>

Latest revision as of 05:49, 28 December 2018

IL1R1-AS1, IL1R1 antisense RNA 1 is a long non-coding RNA that could be a novel circulating biomarker for the determination of oral squamous cell carcinoma (OSCC).

Annotated Information

Name

IL1R1-AS1: IL1R1 antisense RNA 1 (HGNC:53898)

Aliases

AC007271.3

Characterstics

IL1R1-AS1 located at chromosome 2q12.1 is a long non-coding RNA gene, involved in oral squamous cell carcinoma.[1]

Function

Please input information here.

Regulation

AC007271.3 was up-regulated approximately 2-fold in OSCC cell lines. [1]

Expression

In an expanded case-control study, lncRNA AC007271.3 was differentially expressed and its aberrant levels in OSCC patients were significantly associated with clinical stage, especially in early-stage disease. AC007271.3 overexpression was significantly associated with degree of pathological differentiation (p=0.022), clinical stage (p=0.005), lymphatic metastasis (p< 0.002), and smoking history (p=0.011) but not with age, sex, or alcohol history. [1]. It was also up-regulated in breast cancer cells.[2]

Diseases

  • Breast cancer [2]
  • Oral squamous cell carcinoma [1]

Labs working on this lncRNA

  • Department of Oral & Maxillofacial Surgery, NanFang Hospital, Southern Medical University, Guangzhou, China
  • State Key Laboratory of Organ Failure, Institute of Antibody Engineering, School of Laboratory Medicine and Biotechnology, Southern Medical University, Guangzhou, China

References

  1. 1.0 1.1 1.2 1.3 Shao T, Huang J, Zheng Z, Wu Q, Liu T & Lv X. SCCA, TSGF, and the Long Non-Coding RNA AC007271.3 are Effective Biomarkers for Diagnosing Oral Squamous Cell Carcinoma[J]. Cellular Physiology and Biochemistry. 2018, 47(1):26-38.
  2. 2.0 2.1 Huang L, Zeng L, Chu J, Xu P, Lv M, Xu J et al. Chemoresistance‑related long non‑coding RNA expression profiles in human breast cancer cells[J]. Mol Med Rep. 2018, 18(1):243-253.

Sequence

>ENST00000428188.1 Homo sapiens lncRNA IL1R1-AS1 cDNA

000001 GGTAAATTAA TCTCTCAACT GGTTGAACAC AGCTTTAGAG ATGTCAACAG CCTCCTATGA GTCTAGAGTC AGGTGGTACA 000080
000081 GGCTCAACTG GTCTAACAGC TGCAAATTTT GAGAGACTGC TGTGCTAATG TTTGGGGCTC AGATTTAAGG TATAGGTATG 000160
000161 ATTTACGTAC TTTGAGCAGC CAAGCCTTCT TCAGAAGAAA CCTGAGCGGC ATGTGCTCCT CCCCACCTGC TTCCCCACAA 000240
000241 CAGGAAGAAC TCTCTGCAGA AGGTCTCCTC ACCTTGTTGA GGCCTGGGAA TGTGCAAATG TGCAGGATTT TCCACACTAT 000320
000321 TCGAGAGAGA GAGTAAATAA ACTTGTGTAA GTTAATTGCA TCAACTACAA ATAAGACCTG TA