Difference between revisions of "ENST00000505389.1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>GCGTGGCCCCGGGAGGCGGCGGACGCGGGGACATCTTCTCAGCGCGCGGATTCTCTCCACGGTCCGGCCTCCCCGTCCCCGCCCCGCCCTCGCGCCAGCCACCTCCGGCCGCCGGCTCAGATCTCTGGAAGGGACTCAACAAAGCTTTCCTAAATTAATTGGCTCTGACGGTACCTTCTTAAGGATTTCTGGTGTGGCTCTGACATATAAGCAACTCAGATAACTACAGAAAACTGTGTGTAAAAATCAGCCCACCAGTATTTGAAACAAGTATGCACTGTTCTTT</dnaseq>|
 
sequence = <dnaseq>GCGTGGCCCCGGGAGGCGGCGGACGCGGGGACATCTTCTCAGCGCGCGGATTCTCTCCACGGTCCGGCCTCCCCGTCCCCGCCCCGCCCTCGCGCCAGCCACCTCCGGCCGCCGGCTCAGATCTCTGGAAGGGACTCAACAAAGCTTTCCTAAATTAATTGGCTCTGACGGTACCTTCTTAAGGATTTCTGGTGTGGCTCTGACATATAAGCAACTCAGATAACTACAGAAAACTGTGTGTAAAAATCAGCCCACCAGTATTTGAAACAAGTATGCACTGTTCTTT</dnaseq>|
 
}}
 
}}
[[Category:Intergenic]][[Category:lnc-WWC2-1]][[Category:NONHSAG039439]][[Category:ENSG00000248266.1]]
+
[[Category:Intergenic]][[Category:lnc-WWC2-1]][[Category:NONHSAG039439]][[Category:ENSG00000248266.1]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000505389.1

Source

Gencode19

Same with

lnc-WWC2-1:1,NONHSAT099437

Classification

intergenic

Length

286 nt

Genomic location

chr4+:183066005..183111535

Exon number

2

Exons

183066005..183066124,183111370..183111535

Genome context

Sequence
000001 GCGTGGCCCC GGGAGGCGGC GGACGCGGGG ACATCTTCTC AGCGCGCGGA TTCTCTCCAC GGTCCGGCCT CCCCGTCCCC 000080
000081 GCCCCGCCCT CGCGCCAGCC ACCTCCGGCC GCCGGCTCAG ATCTCTGGAA GGGACTCAAC AAAGCTTTCC TAAATTAATT 000160
000161 GGCTCTGACG GTACCTTCTT AAGGATTTCT GGTGTGGCTC TGACATATAA GCAACTCAGA TAACTACAGA AAACTGTGTG 000240
000241 TAAAAATCAG CCCACCAGTA TTTGAAACAA GTATGCACTG TTCTTT
[back to top]