Difference between revisions of "ENST00000453561.2"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>ACACTGAGACTTTTCACATCTCACTGTCACTTCTTGGAAGGGCTCTCTACCTCGTCTGCCTGCTGAGCAACCTCTTGGGGAGACACGGGCCCTCTTGAGTCACTGAACTTGAGCTATTTGGTGTTGGGAGCTTATAGCTTCATTGCACTGTGTGTGGCATTTGGGTCCTGTTTGGCAGCAATGACTGCCTTTCTGTTTAGTGTCTGTGTGCTATGAAGATTGCACACAGGGGTCCAGATGCATCCTGTTTTGAGAATGTTAATGGATACACCAGCTGCTGCTTTAGATTTCACCCATTGGCG</dnaseq>|
 
sequence = <dnaseq>ACACTGAGACTTTTCACATCTCACTGTCACTTCTTGGAAGGGCTCTCTACCTCGTCTGCCTGCTGAGCAACCTCTTGGGGAGACACGGGCCCTCTTGAGTCACTGAACTTGAGCTATTTGGTGTTGGGAGCTTATAGCTTCATTGCACTGTGTGTGGCATTTGGGTCCTGTTTGGCAGCAATGACTGCCTTTCTGTTTAGTGTCTGTGTGCTATGAAGATTGCACACAGGGGTCCAGATGCATCCTGTTTTGAGAATGTTAATGGATACACCAGCTGCTGCTTTAGATTTCACCCATTGGCG</dnaseq>|
 
}}
 
}}
[[Category:Intergenic]][[Category:ENSG00000225278.3]]
+
[[Category:Intergenic]][[Category:ENSG00000225278.3]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000453561.2

Source

Gencode19

Same with

,

Classification

intergenic

Length

302 nt

Genomic location

chr1-:143236905..143240414

Exon number

2

Exons

143236905..143237080,143240289..143240414

Genome context

Sequence
000001 ACACTGAGAC TTTTCACATC TCACTGTCAC TTCTTGGAAG GGCTCTCTAC CTCGTCTGCC TGCTGAGCAA CCTCTTGGGG 000080
000081 AGACACGGGC CCTCTTGAGT CACTGAACTT GAGCTATTTG GTGTTGGGAG CTTATAGCTT CATTGCACTG TGTGTGGCAT 000160
000161 TTGGGTCCTG TTTGGCAGCA ATGACTGCCT TTCTGTTTAG TGTCTGTGTG CTATGAAGAT TGCACACAGG GGTCCAGATG 000240
000241 CATCCTGTTT TGAGAATGTT AATGGATACA CCAGCTGCTG CTTTAGATTT CACCCATTGG CG
[back to top]