Difference between revisions of "ENST00000435112.1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>CTCAGCCCGTCTGTACCCAGGCGCTCATTAGAACAGCGTGTTGCTCCACACCGCCTTGTGGTGTTTGTTACCGCGCTCTTGGGGTTCGAACCGATACAGCAGGCTTGCAGCTATTTCATTGGTTTAAACTTTTATTTTTTTATTGCAAATGAAAATTACTATCAACTATCATTACAAAGCTGTAGAATATGAAGTTCGAAGGAAAACGCTGAATCAGTATACAAAAGCGTCTCAATCAGACTCATCCATTTTGAAGCAATTCCTCTGCCATTTTGCCACCTCCTCTCAAATTCAGCGACTTACCAGAAAGCCTGTGTGGATGAATATTGCTTCCAGGAGTCACATAATTACATCTAAAATCATAGAATGTTAGAGCTGGAGGAATCTTTAGAGTTTGCCCAAGGTCCTTCACCAGCATTTTACAGAAGATTCTTCGATTTAACTGCTCTTAATTACATCCCGTTGCACTGGCCCCATCAAGTTGCTTTAAACAGCCCTTCTAGTCAACAGAGCTGCAGAGAAAAACCTTGAGCTGTCACACTTCATTTGTGAGAACACTCCAGAGCTTCCTCCAGCTGCTGATTCCAAACCAGCTTCAC</dnaseq>|
 
sequence = <dnaseq>CTCAGCCCGTCTGTACCCAGGCGCTCATTAGAACAGCGTGTTGCTCCACACCGCCTTGTGGTGTTTGTTACCGCGCTCTTGGGGTTCGAACCGATACAGCAGGCTTGCAGCTATTTCATTGGTTTAAACTTTTATTTTTTTATTGCAAATGAAAATTACTATCAACTATCATTACAAAGCTGTAGAATATGAAGTTCGAAGGAAAACGCTGAATCAGTATACAAAAGCGTCTCAATCAGACTCATCCATTTTGAAGCAATTCCTCTGCCATTTTGCCACCTCCTCTCAAATTCAGCGACTTACCAGAAAGCCTGTGTGGATGAATATTGCTTCCAGGAGTCACATAATTACATCTAAAATCATAGAATGTTAGAGCTGGAGGAATCTTTAGAGTTTGCCCAAGGTCCTTCACCAGCATTTTACAGAAGATTCTTCGATTTAACTGCTCTTAATTACATCCCGTTGCACTGGCCCCATCAAGTTGCTTTAAACAGCCCTTCTAGTCAACAGAGCTGCAGAGAAAAACCTTGAGCTGTCACACTTCATTTGTGAGAACACTCCAGAGCTTCCTCCAGCTGCTGATTCCAAACCAGCTTCAC</dnaseq>|
 
}}
 
}}
[[Category:Antisense]][[Category:lnc-ABCA5-2]][[Category:NONHSAG022634]]
+
[[Category:Antisense]][[Category:lnc-ABCA5-2]][[Category:NONHSAG022634]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000435112.1

Source

Gencode19

Same with

lnc-ABCA5-2:1,NONHSAT055607

Classification

antisense

Length

599 nt

Genomic location

chr17-:68013465..68125000

Exon number

5

Exons

68013465..68013533,68015629..68015733,68018220..68018338,68124210..68124298,68124784..68125000

Genome context

Sequence
000001 CTCAGCCCGT CTGTACCCAG GCGCTCATTA GAACAGCGTG TTGCTCCACA CCGCCTTGTG GTGTTTGTTA CCGCGCTCTT 000080
000081 GGGGTTCGAA CCGATACAGC AGGCTTGCAG CTATTTCATT GGTTTAAACT TTTATTTTTT TATTGCAAAT GAAAATTACT 000160
000161 ATCAACTATC ATTACAAAGC TGTAGAATAT GAAGTTCGAA GGAAAACGCT GAATCAGTAT ACAAAAGCGT CTCAATCAGA 000240
000241 CTCATCCATT TTGAAGCAAT TCCTCTGCCA TTTTGCCACC TCCTCTCAAA TTCAGCGACT TACCAGAAAG CCTGTGTGGA 000320
000321 TGAATATTGC TTCCAGGAGT CACATAATTA CATCTAAAAT CATAGAATGT TAGAGCTGGA GGAATCTTTA GAGTTTGCCC 000400
000401 AAGGTCCTTC ACCAGCATTT TACAGAAGAT TCTTCGATTT AACTGCTCTT AATTACATCC CGTTGCACTG GCCCCATCAA 000480
000481 GTTGCTTTAA ACAGCCCTTC TAGTCAACAG AGCTGCAGAG AAAAACCTTG AGCTGTCACA CTTCATTTGT GAGAACACTC 000560
000561 CAGAGCTTCC TCCAGCTGCT GATTCCAAAC CAGCTTCAC
[back to top]