Difference between revisions of "ENST00000435111.1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>TCCCCCCGAGTTGGTAGAATTAGAAACTGCTGGAGTTTGAACTCTGCACTGTGTTGTCCTGTGAAGGTCCTGATGTGCCTGCAATTGTCTTCTTTGTTAGGTTGTTCAAGAGGATGCTTTGAGAAGAAACAGAATAAGAGGTGGATCGAGTGCTTATAGTTTTTCTTCAGGAAGACTCACTGGCTCCAAACAGTCACACACACACACAACCCACATTGCAGTGCCTCACTTTTATTTGCTTGTCAGATGCTTATGACACGCTCAATACATATTTGCTGAAATTAACCTAATGTTTTTAAAGAATGTTCCAAATAACTTTTTTTGGGGACAGAGTCTCACTCTGTCACCCAGGCTGGCATGTAGTGGCAAAATATCGGCTTGCTACAGCCTCTGCCTCCTGGTTCCATGTAATTATCCTGCCTCAGCCTCCTGAGTAGGTGGAACTACAGATGCACACCACCACACCCTGATAATTTTTGTATTTTTTAGTAGAGATGGGGTTTCATCATATTGGCCAGGCTCATGATCCACCCACCTCGA</dnaseq>|
 
sequence = <dnaseq>TCCCCCCGAGTTGGTAGAATTAGAAACTGCTGGAGTTTGAACTCTGCACTGTGTTGTCCTGTGAAGGTCCTGATGTGCCTGCAATTGTCTTCTTTGTTAGGTTGTTCAAGAGGATGCTTTGAGAAGAAACAGAATAAGAGGTGGATCGAGTGCTTATAGTTTTTCTTCAGGAAGACTCACTGGCTCCAAACAGTCACACACACACACAACCCACATTGCAGTGCCTCACTTTTATTTGCTTGTCAGATGCTTATGACACGCTCAATACATATTTGCTGAAATTAACCTAATGTTTTTAAAGAATGTTCCAAATAACTTTTTTTGGGGACAGAGTCTCACTCTGTCACCCAGGCTGGCATGTAGTGGCAAAATATCGGCTTGCTACAGCCTCTGCCTCCTGGTTCCATGTAATTATCCTGCCTCAGCCTCCTGAGTAGGTGGAACTACAGATGCACACCACCACACCCTGATAATTTTTGTATTTTTTAGTAGAGATGGGGTTTCATCATATTGGCCAGGCTCATGATCCACCCACCTCGA</dnaseq>|
 
}}
 
}}
[[Category:Intergenic]][[Category:lnc-VCY1B-1]][[Category:NONHSAG055799]][[Category:ENSG00000223517.1]]
+
[[Category:Intergenic]][[Category:lnc-VCY1B-1]][[Category:NONHSAG055799]][[Category:ENSG00000223517.1]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000435111.1

Source

Gencode19

Same with

lnc-VCY1B-1:1,NONHSAT139517

Classification

intergenic

Length

540 nt

Genomic location

chrY-:16388092..16389369

Exon number

2

Exons

16388092..16388491,16389230..16389369

Genome context

Sequence
000001 TCCCCCCGAG TTGGTAGAAT TAGAAACTGC TGGAGTTTGA ACTCTGCACT GTGTTGTCCT GTGAAGGTCC TGATGTGCCT 000080
000081 GCAATTGTCT TCTTTGTTAG GTTGTTCAAG AGGATGCTTT GAGAAGAAAC AGAATAAGAG GTGGATCGAG TGCTTATAGT 000160
000161 TTTTCTTCAG GAAGACTCAC TGGCTCCAAA CAGTCACACA CACACACAAC CCACATTGCA GTGCCTCACT TTTATTTGCT 000240
000241 TGTCAGATGC TTATGACACG CTCAATACAT ATTTGCTGAA ATTAACCTAA TGTTTTTAAA GAATGTTCCA AATAACTTTT 000320
000321 TTTGGGGACA GAGTCTCACT CTGTCACCCA GGCTGGCATG TAGTGGCAAA ATATCGGCTT GCTACAGCCT CTGCCTCCTG 000400
000401 GTTCCATGTA ATTATCCTGC CTCAGCCTCC TGAGTAGGTG GAACTACAGA TGCACACCAC CACACCCTGA TAATTTTTGT 000480
000481 ATTTTTTAGT AGAGATGGGG TTTCATCATA TTGGCCAGGC TCATGATCCA CCCACCTCGA
[back to top]