Difference between revisions of "ENST00000434999.1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>GAGCGATCCCGGAAGGAGCCGAAGCGACAATGCGGGGGAAGAGATAGAGTCTTCCTCTGTCGCCTAGGCTGGAGTGCAGTGGCGCGATCTCGGCGCACCGCAACCTCTGCCTCCCGGGTTCAAGCGAATTCTCCTGCCTCAGCCTCCGGAGTAGCTGGGATTACAGATGTGCTCCACCATGCCCGGCTAATTTTTGTATTTTTAGTAGAGATGGGGGGGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTTGTGATCCACTAGCTTCGGCCTCCCGAAGTTCTGGGATTACAGGCATGAGCCACCACACCCGGATGAATTATGCCATTTTTAAGGCAAAGGTCTCCGTAACTATTAATTTCTCTGTCCTTCTAATCTGTATTCCCTGAGAAATTAATTGGGCTGGCAAGTCAAAGCCCTGAACCCCAGCTGCAGCTTTCTGAGCTTGTTCTGTCCATCTGTGAAGTAAGGCAATGAGAAGTGAGTCGGGGAACGGAACCCACGATGCGTCAGAGGAGTGTTCCAGTTGCACACACACTCCCCAGCCACCTGGCAGCTCAGTCTATAATC</dnaseq>|
 
sequence = <dnaseq>GAGCGATCCCGGAAGGAGCCGAAGCGACAATGCGGGGGAAGAGATAGAGTCTTCCTCTGTCGCCTAGGCTGGAGTGCAGTGGCGCGATCTCGGCGCACCGCAACCTCTGCCTCCCGGGTTCAAGCGAATTCTCCTGCCTCAGCCTCCGGAGTAGCTGGGATTACAGATGTGCTCCACCATGCCCGGCTAATTTTTGTATTTTTAGTAGAGATGGGGGGGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTTGTGATCCACTAGCTTCGGCCTCCCGAAGTTCTGGGATTACAGGCATGAGCCACCACACCCGGATGAATTATGCCATTTTTAAGGCAAAGGTCTCCGTAACTATTAATTTCTCTGTCCTTCTAATCTGTATTCCCTGAGAAATTAATTGGGCTGGCAAGTCAAAGCCCTGAACCCCAGCTGCAGCTTTCTGAGCTTGTTCTGTCCATCTGTGAAGTAAGGCAATGAGAAGTGAGTCGGGGAACGGAACCCACGATGCGTCAGAGGAGTGTTCCAGTTGCACACACACTCCCCAGCCACCTGGCAGCTCAGTCTATAATC</dnaseq>|
 
}}
 
}}
[[Category:Antisense]][[Category:lnc-WDR34-2]][[Category:NONHSAG053547]][[Category:ENSG00000228395.1]]
+
[[Category:Antisense]][[Category:lnc-WDR34-2]][[Category:NONHSAG053547]][[Category:ENSG00000228395.1]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000434999.1

Source

Gencode19

Same with

lnc-WDR34-2:1,NONHSAT134967

Classification

antisense

Length

578 nt

Genomic location

chr9-:131291180..131314689

Exon number

4

Exons

131291180..131291279,131299106..131299234,131305658..131305963,131314647..131314689

Genome context

Sequence
000001 GAGCGATCCC GGAAGGAGCC GAAGCGACAA TGCGGGGGAA GAGATAGAGT CTTCCTCTGT CGCCTAGGCT GGAGTGCAGT 000080
000081 GGCGCGATCT CGGCGCACCG CAACCTCTGC CTCCCGGGTT CAAGCGAATT CTCCTGCCTC AGCCTCCGGA GTAGCTGGGA 000160
000161 TTACAGATGT GCTCCACCAT GCCCGGCTAA TTTTTGTATT TTTAGTAGAG ATGGGGGGGT TTCACCATGT TGGCCAGGCT 000240
000241 GGTCTCGAAC TCCTGACCTT GTGATCCACT AGCTTCGGCC TCCCGAAGTT CTGGGATTAC AGGCATGAGC CACCACACCC 000320
000321 GGATGAATTA TGCCATTTTT AAGGCAAAGG TCTCCGTAAC TATTAATTTC TCTGTCCTTC TAATCTGTAT TCCCTGAGAA 000400
000401 ATTAATTGGG CTGGCAAGTC AAAGCCCTGA ACCCCAGCTG CAGCTTTCTG AGCTTGTTCT GTCCATCTGT GAAGTAAGGC 000480
000481 AATGAGAAGT GAGTCGGGGA ACGGAACCCA CGATGCGTCA GAGGAGTGTT CCAGTTGCAC ACACACTCCC CAGCCACCTG 000560
000561 GCAGCTCAGT CTATAATC
[back to top]