Difference between revisions of "ENST00000434993.1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>GTGAAGACAGGCAGAGACTGGGGTAATGCAGCTACAAGGGAATGTCAGAGATTGCTAGCAAACACCAGAAGCTGGAAGAGGCAATTAAGGATTGCTCCCTAGAGCTTTTAGAGGGAGGACGGCTCTGCCACCTGCCTTGTTCTTGGACTCCTAGCCTCCAGAATTAGGTCACCTGTTGGGCAATATCACCATAGACTGAATACAGAAGCAGATATTAGCCTCCAGCCTCCTGCTCATCTGGACACTAGAGAGAGTGGATATTCTAAAAGCAGAAATCTTGACACTTAAGCCAAAAAGCCCTCCCATTCAGAAGGATGTATGGATTTTTCATACTTGCATCTGCGGGACGCAGATGGTCCGAGTCACAAGTAAAGAATGTCTGGTGGTCTTGGGCAGAGAGATTCATGTCATAAGGAATCACTAACACCTTGACTCCAGATCATGGCTTGAAACACACTGGAATGGGATTTTGCATAAAAGAAGAAAGCTCAGGAATGATAAATTTACACACCATGGATCTAGAAGGGAGTCTATAACCCCAGAATCACCATTATTTTGGGTGATCCATATGGCTATCAATTAAAGTGCTACCTGAGTGCTGTTCAACTTCTTGAGATGGATGAAAAAGGAATGAAAGGAGACATAGCAATCTTCAACTCCGCTCCTTTACTTTTGAATAAGAGGTGATGGAAGGCAAGGTCAGAGAGATCTGGGTTCAAATCTCATGATTTAACTGCTATATAACCTTGGCCAAATTATTTAAACTTTGTGTCTGTTTTTACTTAGCAATATAAAGACACTGGTCATACCCACCACTCAGAATTTCAATCAGAACTAAATGAAATAATATATGCAAAGTGCTTAATATAGTACACCTGGCATGGAGTGGTAACTCAATAAATAGATCTTTTGTTATAA</dnaseq>|
 
sequence = <dnaseq>GTGAAGACAGGCAGAGACTGGGGTAATGCAGCTACAAGGGAATGTCAGAGATTGCTAGCAAACACCAGAAGCTGGAAGAGGCAATTAAGGATTGCTCCCTAGAGCTTTTAGAGGGAGGACGGCTCTGCCACCTGCCTTGTTCTTGGACTCCTAGCCTCCAGAATTAGGTCACCTGTTGGGCAATATCACCATAGACTGAATACAGAAGCAGATATTAGCCTCCAGCCTCCTGCTCATCTGGACACTAGAGAGAGTGGATATTCTAAAAGCAGAAATCTTGACACTTAAGCCAAAAAGCCCTCCCATTCAGAAGGATGTATGGATTTTTCATACTTGCATCTGCGGGACGCAGATGGTCCGAGTCACAAGTAAAGAATGTCTGGTGGTCTTGGGCAGAGAGATTCATGTCATAAGGAATCACTAACACCTTGACTCCAGATCATGGCTTGAAACACACTGGAATGGGATTTTGCATAAAAGAAGAAAGCTCAGGAATGATAAATTTACACACCATGGATCTAGAAGGGAGTCTATAACCCCAGAATCACCATTATTTTGGGTGATCCATATGGCTATCAATTAAAGTGCTACCTGAGTGCTGTTCAACTTCTTGAGATGGATGAAAAAGGAATGAAAGGAGACATAGCAATCTTCAACTCCGCTCCTTTACTTTTGAATAAGAGGTGATGGAAGGCAAGGTCAGAGAGATCTGGGTTCAAATCTCATGATTTAACTGCTATATAACCTTGGCCAAATTATTTAAACTTTGTGTCTGTTTTTACTTAGCAATATAAAGACACTGGTCATACCCACCACTCAGAATTTCAATCAGAACTAAATGAAATAATATATGCAAAGTGCTTAATATAGTACACCTGGCATGGAGTGGTAACTCAATAAATAGATCTTTTGTTATAA</dnaseq>|
 
}}
 
}}
[[Category:Antisense]][[Category:ENSG00000226367.1]][[Category:lnc-WNT2-1]]
+
[[Category:Antisense]][[Category:ENSG00000226367.1]][[Category:lnc-WNT2-1]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000434993.1

Source

Gencode19

Same with

lnc-WNT2-1:3

Classification

antisense

Length

918 nt

Genomic location

chr7-:116752346..116785614

Exon number

6

Exons

116752346..116752721,116757955..116758037,116768351..116768397,116770582..116770741,116784221..116784307,116785450..116785614

Genome context

Sequence
000001 GTGAAGACAG GCAGAGACTG GGGTAATGCA GCTACAAGGG AATGTCAGAG ATTGCTAGCA AACACCAGAA GCTGGAAGAG 000080
000081 GCAATTAAGG ATTGCTCCCT AGAGCTTTTA GAGGGAGGAC GGCTCTGCCA CCTGCCTTGT TCTTGGACTC CTAGCCTCCA 000160
000161 GAATTAGGTC ACCTGTTGGG CAATATCACC ATAGACTGAA TACAGAAGCA GATATTAGCC TCCAGCCTCC TGCTCATCTG 000240
000241 GACACTAGAG AGAGTGGATA TTCTAAAAGC AGAAATCTTG ACACTTAAGC CAAAAAGCCC TCCCATTCAG AAGGATGTAT 000320
000321 GGATTTTTCA TACTTGCATC TGCGGGACGC AGATGGTCCG AGTCACAAGT AAAGAATGTC TGGTGGTCTT GGGCAGAGAG 000400
000401 ATTCATGTCA TAAGGAATCA CTAACACCTT GACTCCAGAT CATGGCTTGA AACACACTGG AATGGGATTT TGCATAAAAG 000480
000481 AAGAAAGCTC AGGAATGATA AATTTACACA CCATGGATCT AGAAGGGAGT CTATAACCCC AGAATCACCA TTATTTTGGG 000560
000561 TGATCCATAT GGCTATCAAT TAAAGTGCTA CCTGAGTGCT GTTCAACTTC TTGAGATGGA TGAAAAAGGA ATGAAAGGAG 000640
000641 ACATAGCAAT CTTCAACTCC GCTCCTTTAC TTTTGAATAA GAGGTGATGG AAGGCAAGGT CAGAGAGATC TGGGTTCAAA 000720
000721 TCTCATGATT TAACTGCTAT ATAACCTTGG CCAAATTATT TAAACTTTGT GTCTGTTTTT ACTTAGCAAT ATAAAGACAC 000800
000801 TGGTCATACC CACCACTCAG AATTTCAATC AGAACTAAAT GAAATAATAT ATGCAAAGTG CTTAATATAG TACACCTGGC 000880
000881 ATGGAGTGGT AACTCAATAA ATAGATCTTT TGTTATAA
[back to top]