Difference between revisions of "ENST00000434988.1"

From LncRNAWiki
Jump to: navigation, search
Line 42: Line 42:
 
sequence = <dnaseq>AGGCCTTGGGTTACACTCTGATGATGCCAGGATAATCAGACCAGCCTCTGGGAGACCCTCCCCACCAGGCAACAGCTGTCCCTCATCCTCCCAGCTCTGTTCCCATCTGGCCTGGGGAAGTGAGCTTAAGGATTTTTCCGGAAACGAGGAGAGGTCAGCATGCTGAAGTGTTTGGAAGGCATCCGACGGAATGACGGCTGAGGCCCTCACTCTCCACTGAACTCTGCTTGCGGCTGGGGACTGCTCTGTGTCTGCACGTGTTCGCATTTATTAAATGTGGAGGTGCAAAACAAAACAAAACAAAACAAAA</dnaseq>|
 
sequence = <dnaseq>AGGCCTTGGGTTACACTCTGATGATGCCAGGATAATCAGACCAGCCTCTGGGAGACCCTCCCCACCAGGCAACAGCTGTCCCTCATCCTCCCAGCTCTGTTCCCATCTGGCCTGGGGAAGTGAGCTTAAGGATTTTTCCGGAAACGAGGAGAGGTCAGCATGCTGAAGTGTTTGGAAGGCATCCGACGGAATGACGGCTGAGGCCCTCACTCTCCACTGAACTCTGCTTGCGGCTGGGGACTGCTCTGTGTCTGCACGTGTTCGCATTTATTAAATGTGGAGGTGCAAAACAAAACAAAACAAAACAAAA</dnaseq>|
 
}}
 
}}
[[Category:Intergenic]][[Category:lnc-FGFR2-1]][[Category:NONHSAG007054]]
+
[[Category:Intergenic]][[Category:lnc-FGFR2-1]][[Category:NONHSAG007054]][[Category:Transcripts]]

Revision as of 11:51, 16 October 2014

Please input one-sentence summary here.

Annotated Information

Transcriptomic Nomeclature

Please input transcriptomic nomeclature information here.

Function

Please input function information here.

Regulation

Please input regulation information here.

Expression

Please input expression information here.

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

Please input related labs here.

References

Please input cited references here.

Basic Information

Transcript ID

ENST00000434988.1

Source

Gencode19

Same with

lnc-FGFR2-1:1,NONHSAT016705

Classification

intergenic

Length

310 nt

Genomic location

chr10-:123374939..123375353

Exon number

2

Exons

123374939..123375179,123375285..123375353

Genome context

Sequence
000001 AGGCCTTGGG TTACACTCTG ATGATGCCAG GATAATCAGA CCAGCCTCTG GGAGACCCTC CCCACCAGGC AACAGCTGTC 000080
000081 CCTCATCCTC CCAGCTCTGT TCCCATCTGG CCTGGGGAAG TGAGCTTAAG GATTTTTCCG GAAACGAGGA GAGGTCAGCA 000160
000161 TGCTGAAGTG TTTGGAAGGC ATCCGACGGA ATGACGGCTG AGGCCCTCAC TCTCCACTGA ACTCTGCTTG CGGCTGGGGA 000240
000241 CTGCTCTGTG TCTGCACGTG TTCGCATTTA TTAAATGTGG AGGTGCAAAA CAAAACAAAA CAAAACAAAA
[back to top]