RASSF1-AS1

From LncRNAWiki
Jump to: navigation, search

RASSF1-AS1, which was transcribed from the opposite strand on the RASSF1 gene locus in 3p21.3 of 790bp, recruits PRC2 to the RASSF1A promoter, reducing the expression of RASSF1A and increasing cell proliferation.

Contents

Annotated Information

Name

RASSF1-AS1:RASSF1 antisense RNA 1(HGNC nomenclature)

ANRASSF1[1]

Characteristics

Antisense noncoding RNA ANRASSF1 is expressed within the RASSF1 genomic locus and inversely correlated with RASSF1 expression. [1].

ANRASSF1, an endogenous unspliced long noncoding RNA (lncRNA) that is transcribed from the opposite strand on the RASSF1 gene locus through RNA polymerase II ,is 5′-capped and polyadenylated and exhibits nuclear localization and has a shorter half-life compared with other lncRNAs that bind PRC2[1].

It belongs to the category of "Antisense" in lncRNA classification.

Cellular Localization

It exhibits nuclear localization[1].

Function

Proposed model for ANRASSF1 function at the RASSF1 genomic locus. [1].

ANRASSF1 formed an lncRNA/DNA hybrid, which mediated the recruitment of SUZ12, a member of PRC2, to the RASSF1A promoter.The recruitment of SUZ12 resulted in a marked increase in the H3K27me3 levels only at the RASSF1A promoter region, without accumulation of the repressive mark either at the RASSF1C promoter or the four neighboring loci. ANRASSF1-mediated gene repression occurred in a highly location-specific manner, as only the RASSF1A isoform, which overlaps the antisense transcript, was affected. [1].

ANRASSF1 expression is significantly higher in triple negative sample, which suggests a putative role in breast cancer and implies that it can be used as a potential cancer biomarker.[2]

Expression

ANRASSF1 endogenous expression is higher in breast and prostate tumor cell lines compared with non-tumor, and an opposite pattern is observed for RASSF1A[1].

ANRASSF1 overexpression causes a marked increase in both PRC2 occupancy and histone H3K27me3 repressive marks, specifically at the RASSF1A promoter region[1].

Assay Primer Forward primer Reverse primer
qPCR ANRASSF1 5'-GGCAATTAGAACGCTCCTTG-3' 5'-CTGTGCTAGGCGATAGAGATCC-3'[1]
RASSF1A 5'-ACCTCTGTGGCGACTTCATC-3' 5'-GTTCGTGTCCCGCTCCAC-3'[1]
Strand specific RT ANRASSF1 5'-CCGCGCAGAATTAGCCTCT-3' 5'-CCAATGAGGAAAGGGGAAGT-3'[1]
Cloning (overexpression and promoter assay) Antisense-ANRASSF1 TGGGTACCGCAGCGGGTGGAGTACTTG 5'-TGAAGCTTCCAATGAGGAAAGGGGAAGT-3'[1]
Antisense-Promoter 5'-AGATCTGACCCAGGACGCGGCAAC-3' 5'-AAGCTTCCAGAGGCCACTCTTGTGC-3'[1]
Sense-Promoter 5'-AAGCTTGACCCAGGACGCGGCAAC-3' 5'-AGATCTCCAGAGGCCACTCTTGTGC-3'[1]

Disease

  • Breast cancer.[2]

Sequence

>gi|565671811|ref|NR_109831.1| Homo sapiens RASSF1 antisense RNA 1 (RASSF1-AS1), long non-coding RNA

000001 ACACGCACGC TTCGCCCCCA GGAATGACCT CATCGCTCCG GAGCTCCACT CACAGACCCC ACCTACCACA GGGAACGGGG 000080
000081 GCGGGTGCCA GCGTCCGGGC AAGCGCACAA GAGTGGCCTC TGGCCGGAGG CGAGGGCGGG AAGGTGCGGG AAGTGCGCGT 000160
000161 GCGCGGAGCC TGGGTCAGCC TGGGCCCGGG TCCGCTTGCA GCGGGTGGAG TACTTGCGGA GCCGGCAATC CAGGCTCCCC 000240
000241 TCCCAGCCCC CGCGCAGAAT TAGCCTCTCT GTGCCGCCGG GAAATCGGCA ATTAGAACGC TCCTTGCGCG CGGCACCCAG 000320
000321 GCAGCCCTCG AGAATGCCTG CACTGTGGCC TGCCCATCCT CGCCCTTCCC ATACGCCCTC GGCCCCGCGC TCACCACGTT 000400
000401 CGTGTCCCGC TCCACCGCGG GTTCCCAGCC CAGGTCCCGG GGCCCGCAAC AGTCCAGGCA GACGAGCGCG CGGCAGCGGT 000480
000481 AGTGGCAGGT GAACTTGCAA TCTGCAGAGA GGCCTGGCGG TGAGGCGGAG GAGCTCCAGG TCGGGGAAAT GTCCCGGAGA 000560
000561 TTGAAGGGAA GCCCCAGGGA GAGGGCCGCT GCTCGCCAGG CTCCGCAGGC CCGACCTATC TCAGTGGGTT ACCTCACACT 000640
000641 GCTACGCGGA CTCTAATGTT GGCCACCTGG GCGTCTGGAA ACCGGCCGGA AGGCCACAGG CAGAGAGGCC TGCTCAACAG 000720
000721 TTGGATCTCT ATCGCCTAGC ACAGAACTTC CCCTTTCCTC ATTGGCAATT AAAAAAACAA CAACAAAAAA

Labs working on this lncRNA

  • Departamento de Bioquímica, Instituto de Química, Universidade de São Paulo, São Paulo, São Paulo, Brasil[1].
  • Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Beckedorff FC, Ayupe AC, Crocci-Souza R, Amaral MS, Nakaya HI, Soltys DT, et al. The intronic long noncoding RNA ANRASSF1 recruits PRC2 to the RASSF1A promoter, reducing the expression of RASSF1A and increasing cell proliferation[J]. PLoS genetics. 2013,9(8):e1003705.
  2. 2.0 2.1 Iranpour M, Soudyab M, Geranpayeh L, Mirfakhraie R, Azargashb E, Movafagh A, et al. Expression analysis of four long noncoding RNAs in breast cancer[J]. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2016,37(3):2933-40.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox