NONHSAT130385

From LncRNAWiki
Jump to: navigation, search

MIR31HG, located at chromosome 9p21.3,transcribed from 4 exons resulting in a spliced transcript of ~2.2 kb and shows significant roles in breast tumorigenesis.

Contents

Annotated Information

Name

MIR31HG: MIR31 host gene(HGNC nomenclature)

LOC554202[1]

Characteristics

The LOC554202 gene which does not contain an open reading frame is located at chromosome 9p21.3. LOC554202 is transcribed from 4 exons resulting in a spliced transcript of ~2.2 kb[1].

Function

qRT-PCR analysis of lncRNA LOC554202 in breast cancer tissues and breast cancer cell lines.[1]

Higher expression of Loc554202 in breast cancer tissues was associated with larger tumor size and a more advanced clinical stage, suggesting that the expression of Loc554202 could be used as a diagnostic and prognostic breast cancer marker[1].

Disease

  • Breast cancer

Expression

Loc554202 is significantly increased compared with normal control, and associated with advanced pathologic stage and tumor size. Moreover, knockdown of Loc554202 decreased breast cancer cell proliferation, induced apoptosis and inhibits migration/invasion in vitro and impeded tumorigenesis in vivo[1].

LOC554202 is down-regulated in the TNBC cell lines of basal subtype and over-expressed in the luminal counterparts, CpG island methylation plays an important role in silencing of the LOC554202 genes[1].

The primer for qRT-PCR as follows:

Primer Forward Primer Reverse Primer
GAPDH 5'-AGAGGCAGGGATGATGTTCTG-3' 5'-GACTCATGACCACAGTCCATGC-3'[1]
Loc554202 5'-TCTCTGGTGCTTCCCTCCTT-3' 5'-GATCTAAGCTTGAGCCCCCA-3'[1]

The target sequences for the si-LOC554202 included:

si-RNA Primer
si-Loc554202-1 GCAGGUAGAGAUGGAUUCCUGGAAA[1]
si-LOC554202-2 GGAGCGCUUUGUGUGAGAAGUUGAA[1]
si-LOC554202-3 CCUGGUUGAGCUGAGGUCUUCAUAG[1]

Labs working on this lncRNA

  • Department of Oncology, Second Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu, PR China[1].
  • Department of Molecular Cardiology, Cleveland Clinic, Cleveland, OH, USA[2].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Shi Y, Lu J, Zhou J, Tan X, He Y, Ding J, et al. Long non-coding RNA Loc554202 regulates proliferation and migration in breast cancer cells[J]. Biochemical and biophysical research communications. 2014,446(2):448-53.
  2. Augoff K, McCue B, Plow EF, Sossey-Alaoui K. miR-31 and its host gene lncRNA LOC554202 are regulated by promoter hypermethylation in triple-negative breast cancer[J]. Molecular cancer. 2012,11:5.

Basic Information

Transcript ID

NONHSAT130385

Source

NONCODE4.0

Same with

LOC554202, MIR31HG

Classification

intergenic

Length

2148 nt

Genomic location

chr9-:21454267..21559697

Exon number

4

Exons

21454267..21455943,21476898..21477034,21477168..21477291,21559488..21559697

Genome context

Sequence
000001 AGGTTCCACG TCCGGCGCCT GGAGAAGGAA GACGCGCGTC CCCGGCCGCG GCGCCGAAGC CGGCTGGGGG ACCGCCTGGT 000080
000081 CCCGGGCCAG AGCTGGGAGG CGGTGTTCCG TGAGCCGCCT GGTCTGGGGT GCGGGGGGCG GGAAGCGGCC CCTTCGTGTG 000160
000161 CGCTTGGGCG AGGCCGGGCG GCGCTTCTGT CCTCCTACTC GGACCCGCAG GTTTCTGGTC CTCATACCGT GTGGTTGAGT 000240
000241 GAAATCAAAA CTTCCACGAT AGCAATGCTG ATTGGACAAA GAATGTGTTG TGGACACAAA ACCAAACTCT GGAGGACAGA 000320
000321 GGATTCATTC CAAGGGTCTG CTTGTATTCA ATGACTGGTC TACGTGGGGG TGTGAAGTCC CCTTACTCCA CCTGTGAAGA 000400
000401 GTCTTCCCAG TTTCAGACCA CCCTCCCAGC CTCCTGTTAT TGGCTAAGGC CATTTTGTGA CTACACTGCA GGTAGAGATG 000480
000481 GATTCCTGGA AATACCTCCT CAAGGCCAGT GTAGAGCCCT CAATCACCCA CTGCCCCCAG CTTCTCCTTC TCCCATCTCC 000560
000561 TGCACCAAGC AGGTCTCCAG GTGTTCCAGC TGCTGATGAC GTAAAGTGTG GAGTTGGTCC AGGAAGGTCA TGTTCCATGC 000640
000641 AGCAGAGGAG CGCTTTGTGT GAGAAGTTGA AGACCTGCTG TAACACATCA TAGAGGAAAG ACATAGCCTG GGCCTTCTGC 000720
000721 AACTGGCTGA CTTCCACCTT CTCCTGGGGG AATCTGAAGT CACTTCTGTC CTTTAGACAC AAGAAGGGAG AGATTCTCCT 000800
000801 CATTTGGCCC AAAAGCACCA AGGTGTTCCT GCCTAGCAGG CCATGGTTCT GAGGCAGGTT ATATCCTAGA GATCCAGAAG 000880
000881 AGCCACAGCT GCACACCTCT AGGGCTGCCA GTAGAGGGAA GAGGAGGGCC ATTGAGAAAT CAGGATGCTT TTGGCCTGGT 000960
000961 TGAGCTGAGG TCTTCATAGA ACCTTGGATC CTAGGTTCTA TGAAGACATT CTATCTATGC ATGGCTTTAA TGGAGCACAA 001040
001041 ATAGTTTTCA TTTTTCTGAG CATTTCTCTA AATTTTTAAT TCCATTTATT GTTTTCATTT ACATGTCTTC TATATCAGCA 001120
001121 TCCACAACCT TTTGGCCACC AGTTTGGTGG AAGATAATTT TTCCACGAAA AATGGGGTCA GGGAGGGAAT GCTTTCAGAG 001200
001201 GCATTAGATT CTCATTAGGA GACCACAACC TAGATCCTTC GCATCTGCAC TTCACAATAG GGTTCCTGCT CTTTTGAGAA 001280
001281 TCCAATGCCA CTGCTGATCT GACAGGAGGC AGAGCTCAGG CGTTAATGCT TGTTGGTTGG CCTGCTTGCC TCCTGCTGTG 001360
001361 CGGCCCTGTT CCTACCAGGC CAGGACCAGT ACCCCGGTCC ATGGATGGGG GTTGAAAAAC CTTGTTCTAT ATGACCTAAA 001440
001441 AGGAGGTCAT CACTCTACAC TCTTGATTTT TGCAATGGAT GTTCAATATT CCCAGTAAAC TTAAGATATA TCAATCCAAA 001520
001521 TGAATATTGA TCAATCAGAT GAGAAACATC TTTGTGCTAC TGTTAGAAGT ATATACTTTT AGCCCAGATC CTAGCCTCCA 001600
001601 GTTTTACCCT CCATTTTGCA TAGGAAATCA GGATCCCTGG GCCCTATGGG TTTCTGTATT CAGTTAGGAA ATTACCTATC 001680
001681 TCTGGAAATT AAACTTTTTA GGACTATCTT TGTTTGATAT TTGATTCACA GAAGACGTTG ATGGTTATTA GTGAAAGAAC 001760
001761 TTCTCTGGTG CTTCCCTCCT TCTAGAATAT ATTCATTCAG GTTCATGTGG TTATGCTTCC CTGGGGGCTC AAGCTTAGAT 001840
001841 CAATGAACAT TGCCTTTTTT GCATTATTTT CTTACTGGAG AAATATAGCA CTCCTCAGGC TGCGCCAATA CCCCTAAAAG 001920
001921 AAATTCTGTT GGTTTGTTTT TTTTTCTTTT TTAAGATGCA TATGGGTGTG GAAATTTTAA TCTTAAAATA ATGTTATTTC 002000
002001 CTCAGCAGTG ATGATTCACA AGGTATTTAT CACATCAAGT CACTCCCTAA ATGCAGGCTC ACCACATCCT GATGACTTTA 002080
002081 GAACTCCTTT TCCAGGGAGG TTCTTGCTTC TTTGTTGCCA AAACAATAAA TCCTTTGTGA CCTTTGTC
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox