NONHSAT123382

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT123382" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT123382&oldid=1272135 (Last update: Jun 30, 2016). [See details]

LINC-PINT, p53 induced long intergenic non-protein coding RNA, functions by regulating targeting of PRC2 to specific genes for repression

Contents

Annotated Information

Name

LINC-PINT: long intergenic non-protein coding RNA, p53 induced transcript(HGNC nomenclature)

FLJ43663, LincRNA-Pint, "p53 induced noncoding transcript", PINT[1]

Characteristics

Pint is a p53-regulated long intergenic non-coding RNA (lincRNA).[1]

Pint is aubiquitously expressed lincRNA that is finely regulated by p53[1].

Cellular Localization

In mouse cells, Pint is a nuclear lincRNA[1].

Function

PINT is a lincRNA specifically regulated by p53 in mouse and human cells. In mouse cells, PINT promotes proliferation and survival, and functions by regulating targeting of PRC2 to specific genes for repression[1].

Human PINT is a p53-regulated long intergenic non-coding RNA (lincRNA) downregulated in colorectal cancer. [1]

In the human ortholog, PINT, is also transcriptionally regulated by p53, and its expression correlates with similar cellular pathways to those of the mouse lincRNA. However, in contrast to the mouse Pint, human PINT is a negative regulator of proliferation and survival, and is downregulated in colon cancer, representing a novel tumor suppressor candidate lincRNA[1].

Regulation

p53[1]

Diseases

  • colon cancer[1]

Expression

PINT appears to be significantly downregulated in primary colon tumors, and its overexpression in human tumor cells inhibits their proliferation.

Oligonucleotides

Antisense Oligos(ASOs) Sequence Position
ASO#1 GCCGACTCCCCATCTCTGCC   ex4[1]
ASO#2 GGCACCCATCTCCCTTGCAA intronic[1]
ASO#3 TAGCTCAGTTCTTCTAACGC   ex3[1]
ASO#4 CCTTTAGTTAGCTTTGGTCT intronic[1]
ASO CTRL#1 CCTTCCCTGAAGGTTCCTCC[1]
ASO CTRL#2 TAGTGCGGACCTACCCACGA[1]  
siRNA Sequence Supplier
siRNA P53#1 AGAAGAAAAUUUCCGCAAA   Ambion[1]
siRNA P53#2 ACAGCGUGGUGGUACCUUA    Ambion[1]
siRNA control Not available from supplier   Ambion[1]
shRNA cloning Forward Reverse
Ezh2 CCGGCGGCTCCTCTAACCATGTTTACT   AATTCAAAAACGGCTCCTCTAACCATG[1]
Scramble CCGGCAACAGCCACAACGTCTATATCT AATTCAAAAACAACAGCCACAACGTCT[1]

Labs working on this lncRNA

Center for Applied Medical Research, University of Navarra, 55 Pio XII Avenue., 31008 Pamplona, Spain[1]

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 Marin-Bejar O, Marchese FP, Athie A, Sanchez Y, Gonzalez J, Segura V, et al. Pint lincRNA connects the p53 pathway with epigenetic silencing by the Polycomb repressive complex 2[J]. Genome biology. 2013,14(9):R104.

Basic Information

Transcript ID

NONHSAT123382

Source

NONCODE4.0

Same with

LINC-PINT,FLJ43663, LincRNA-Pint, PINT

Classification

intergenic

Length

2946 nt

Genomic location

chr7-:130628919..130793562

Exon number

4

Exons

130628919..130630594,130668812..130668868,130737184..130737314,130792479..130793562

Genome context

Sequence
000001 GTCATATCTC CGTACCTCAC TTCCTGACAC AAACAAGTTT TCACTGTTGT CAGCAACAAA GCCCTAATAT AGCTGCGGAA 000080
000081 GAGAAAAACT GCATTGCATT TTGCCTCCTG CAAGCATCAT CAACAGTTAC TGGAGGAACG TAATTCCAGA AAGCTTGAAA 000160
000161 GCCGTGGTGA TGGTAATTAT GTATCAAATG CCTGGTTCTA TTTCTGTTAT TATTGTTTTG TCATTTCTGT TTTCCCAGCG 000240
000241 ATCTGACTGA ACTCGCAGAG GGACAAATCC AGTTTTTCTT TTTGACTTTT GTCAAACTAA ATCAGGCCTG ATAGAAAACT 000320
000321 CATTGCTCTC CGGGGAAACA AAGTAGGAGC CACGAAATGT CATTTTAACA GAGCGTGGGT TTGGTGACTG TAGGAAAGGA 000400
000401 TTTGAGGACG CTCCTTCTGT TCGGCTTCCT ATGTCATGAG CACAGGCTCC ACGCACGCAC AGACACCACG GCTCCCGGAT 000480
000481 GCTGTGGCTC CCCGATCGGG GCTCCTGCAG CGCCAGAAGC CCCTCCGGGA TGCTTCGAGG GGCTCCCGGT GGGTGGAGGT 000560
000561 ACGGACGCCG CTGCGGCCGC CGCCGCCAGT CCTGCTGCTG TTGTTGCTGC TGCAGTCACG TGGGAGCCCC TTTAAGTTTC 000640
000641 CATAGAGAGG CCTCTCTGGT GTCACATGAT GGACATGATA TAATGAAACA ACATTGTGGA GAGGAAAGCA TTAGGGGAGC 000720
000721 CCACGGCTAC AAAAACAAGT GAGTGAGAAG AGGTGGGAGG AAGAGAAACT ACGCCACCTC CCCTGCAGCC GAGTGCACGC 000800
000801 AGCAGCCTGG CGTGACAAGT GGGCGACGCC GGGGGGCAGG GAGCCGGGGT CCTTGGCCCT GGCCGGGGAC CCCACCGCCC 000880
000881 ACCGCGCGGA GGACAACTTT TAGCCGGCAG CCCAGACCAG CGCGGCACCT GTCTCCGGAG TCTCCACCGC TCCTCCCGAT 000960
000961 TCATCCCAGG GAAATTCTCA AGAATACGCT CTACAAATCT ACGTGCGCAT CATTTTCACC TCGCGTCGCG CCCGGGAGGA 001040
001041 AGGAACGAGG CAAGGAGCTA AAGCAGCGTG CGTTCAGCCC TGGGGCATTT TATTAATGCT TTTACGAGTT AGAAGAGTTG 001120
001121 GGATAATTTG CCATCTGGAG TTTCTCTGCC TTGCTGATCT GAGCTCAGAC CTGCCAATTT ACCAGAGATA ATTGATAACA 001200
001201 CCCTGTAACA GCTGAGAGGA AAATGGAAGA AACGGAGATA CTTTTAGTGA AGCAGAATAA ACCACTGAAC AGGAAAAATG 001280
001281 AGGAAGCTGT GAGTACCAGT GGAAGGAACG AGCCAGGAAG AGGGACTGGA ACCATCTCAG AAGCCATGCC CCTCAGGCTG 001360
001361 GAACTTGCCC TGTCTCCTCG CAGATGAGGT AGGAGGCTCA GCACGGGCTG GTGGGAGCAG CCCACAGCAG CAGTGAGGGT 001440
001441 CAGTGGGCCT GTGAGTTAAG AAGAAGGTGG CACAGAGCGA GGGTCTCTGG ATCCTGACTG TTTGACTTTT CCATGATTAG 001520
001521 GATAAGTAGC CAGGGCTTGG CTAGTTGGAG AGTTACTCGA ACCTCAGGTG ACAGTTGTAA GGCAGCACAT AGTGAAAAAG 001600
001601 AGTCCTAGCC TGGGAAAGTC CAAAACCTTA GGTCTGGTTT CAGTTCACTC ACCTATCTCT GTGACATAGC AAAGTCTGTT 001680
001681 AATTTCTCTA ATTTTCTGAT TAGTAGTATA GTTGCAGGAA TGAAATAAAA ATGGTCCTGA TTACTCAGAG ATTCATTTAC 001760
001761 TGATTACTCT TTTTGTGACC TGAATAAAGA GTACAACATC TCTCAAAAGG TAACAATATG ATGTTTCAGG AAATTAGAGA 001840
001841 AGTTAAGAGA CTTTGCTGTA TTTACTATAC AGATAGTTGA CTGACAGCTG AGCCCGGACC CAAGATTCAT TTATAAAATG 001920
001921 AAGGAGTTGA GAAGTACATA CTCTGAGGTT TATCCTAAAT AAACTGAAGT CTAGGCAAGT GGCTGAGCTA GGTTTGCCAT 002000
002001 GAATCAATCT GCTGAGTATA TTTCTTGGTA ACTAGTTCAT CTTTCCTTAA TTCAGTCAAC AAATATGATA TCAAGTTTAG 002080
002081 TAAGATGATG ACAGTTGTCA TGTAATACTC CATCTGGAAG ATTGTATGCT TCTCAGCTTC CCTAACTTTT CTTAATCTAC 002160
002161 CTTAAGCTTC CTTTCTGAAA GGTTTCTGTC TTTCCTAACA GTCTCTTCTT TCCGCCAGCT ACCTCTTGTG TTTAAGAATT 002240
002241 AAAGGAAGAT GAGCTAGGAA TCAAGAAATA CGCAGAACTG ATTCCTGTCA CTGGCGCCAC CCTGCCACTT GCCCAGAGCT 002320
002321 GTGGTATAAA TTTTTTTAAT AGGCTGAAAT AAAAATATGA ATAGCATTTT GGTATTAAGC ATTAAATTGA TAAAGGCTAT 002400
002401 GAGATACACC TGCTCTCAAC CATGTTAATT TTTTATTATT GGTATTAATA AATTATTACT TACTAACATA TTAACAAGAA 002480
002481 TTGCATTGAG AAACAAAGCA TCCACAGGCC AAATCTTCTG AATTTCAAAT GTTTATATTA ATGCGTTGTA TTCTAGAAAA 002560
002561 GTAGAATTGT CTTAAGTAGC TTTGTAATAT AAAGTCATCT ATCAGCCCAT TACACCTATT AGAATGTTTT AACCTTTATT 002640
002641 TCCCACTTTT TTGTTTCTAG ACTGAGTGTA CTTGGTCTGG TATTTGTGGC ATAACTTACG GAACACATAA GAATGATACA 002720
002721 GATACTATTT AATGATGACC TAATACAAGC TTAGATAGCT AAGGTGAAAG CTTCTATGGC CTTAACATTT TCCTCTTGAA 002800
002801 GAATGTATTT TCTGTAATAA AATACAGTGG CTACTTGAAA TCTATAAACT TATGTGAGGT CTGGATAAAT CTGAGCAACT 002880
002881 TTCTTCTTTG TGCTCCAGGA ACCTACGCAC TATATATATA AATAAAGCTT AAGTAAACAT CACTGC
[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT123382" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT123382&oldid=1272135 (Last update: Jun 30, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu3.148131760.9912016-06-25 14:27:49[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.01711712016-06-30 14:08:21[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox