NONHSAT121673

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu, Lina Ma (2016) lncRNA: "NONHSAT121673" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT121673&oldid=1272241 (Last update: Jun 30, 2016). [See details]

APTR,a 2303-nucleotides lncRNA, acts in trans to repress the CDKN1A/p21 promoter by recruiting PRC2, which requires a complementary-Alu sequence encoded in APTR for the localization of APTR.

Contents

Annotated Information

Name

APTR: Alu-mediated CDKN1A/p21 transcriptional regulator (non-protein coding)

RSBN1L-AS1:RSBN1L antisense RNA 1 (non-protein coding)[1]

Characteristics

APTR is a 2303-nucleotides lncRNA which expressed from the opposite strand of the intergenic region between PTPN12 and RSBN1L in chromosome 7q21 possesses two sequences complementary to SINE/Alu elements (c-Alu) as well as one sequence complementary to LINE/L2 element[1].

Cellular Localization

  • Nucleoplasm[1]

Diseases

The implication of APTR-mediated p21 silencing in normal cell function and cancer [1].
  • Glioblastomas[1]

Function

LncRNA APTR knockdown inhibits cell proliferation in a p53-independent manner[1]

The 3' portion of APTR specifically interacts with and recruits the PRC2 protein complexes EZH2 and SUZ12 to repress P21 promoter specifically between −1.6 to −4 kb relative to the TSS, which requires the c-Alu elment of APTR.[1].

The level of expression of APTR is important for determining the expression of p21 in GBM cell lines and tumors[1].

APTR can accelerate cell cycle and increase the proliferation of HSCs via negatively regulating p21 in mouse liver fibrosis. [2]

APTR as a new member of TGF-β1-dependent ncRNAs that are involved in liver fibrosis. [2]

Expression

Expression of APTR in fibrotic liver tissues and activated HSCs. [2].

APTR is a capped, poly(A) tailed and spliced lncRNA expressed mainly in nucleoplasm (Figure 1F) and required for proliferation of multiple cell-lines. [1]

APTR expression is upregulated in liver fibrosis. [2].

Experiment Primer Forward primer Reverse primer
RT-PCR APTR 650-950 Primer set1 5’-TGTGGGTACAAAAGGAGAGTAACAT-3’ 5’-GTAGATCTGGAGCTGCAACTACAG-3’[1]
APTR 1832-2158 Primer set 2 5’-GAGGAAGAGAAATTCTGAGGGTAAAGATA-3’ 5’-GATCTGTGCATCACTCTATTCATCCATT-3’[1]
Knockdown siAPTR#1 5'-CCAGGUACUGCCUUCUAAC-3'[1] -
siAPTR#2 5'-CCAUGAUCCGGUAUCACCA-3'[1] -
ChIP/CLIP Region 1 5’-GAGGTCGAGGTTTGAGACCAGCCT-3’ 5’-GTGTGCACGTAACAGAGCGCATCA-3’[1]
Region 2 5’-GTCTGCTGCAAATCTCAGTTTGCCC-3’ 5'-TTATCTCGAGCAGGAAAACGTGGTCTCAGC-3'[1]
Region 3 5’-CAGATTTGTGATGCTAGGAACATGA-3’ 5’-AGAGGCGGAACAAAGATAGAACATT-3’[1]
Region 4 5’-TATGCTGCCTGCTTCCCACCAACA-3’ 5’-TTCCTCACCTGAAAACAGGCAGCC-3’[1]
Region 5 5’-GAGTCAGATTCTGTGTGTGAC-3’ 5’-ATAACTTCTAGCTCACCACCACCAC-3’[1]
Region 6 5’-GGCCTTTCTGGGGTTTAGCCACAA-3’ 5’-CTTCTTCCTCTAACGCAGCTGACCTC-3’[1]
Region 7 5' -TTGTCATTTTGGAGCCACAG-3' 5' -GGGCTCAGAGAAGTCTGGTG-' [1]


Experiment Primer Forward primer Reverse primer
qRT-PCR APTR 5’- TTGCCAAACGGTTCTTTC-3’ 5’- CGGAGGAGAGTAAATACAACAG -3’[2]
Knockdown siRNA1 5'- GUGCAUCAGUGUUGCUUGCdTdT -3' 5'- GCAAGCAACACUGAUGCACdTdT -3'[2]
siRNA2 5'- GGCGAAACCGACACCGAAAdTdT -3' 5'-UUUCGGUGUCGGUUUCGCCdTdT -3'[2]
siRNA3 5'- GCCACUAGCGGUGUUUGUAdTdT -3' 5'- UACAAACACCGCUAGUGGCdTdT -3'[2]

Labs working on this lncRNA

  • Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, Virginia, United States of America. [1]
  • Department of Gastroenterology, Jinshan Hospital of Fudan University, Jinshan, Shanghai, 201508, China [2]

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 Negishi, M. et al. A new lncRNA, APTR, associates with and represses the CDKN1A/p21 promoter by recruiting polycomb proteins. PLoS One 9, e95216 (2014).
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 Yu F, Zheng J, Mao Y, Dong P, Li G, Lu Z, et al. Long non-coding RNA APTR promotes the activation of hepatic stellate cells and the progression of liver fibrosis[J]. Biochemical and biophysical research communications.2015,463(4):679-85.

Basic Information

Transcript ID

NONHSAT121673

Source

NONCODE4.0

Same with

APTR ,RSBN1L-AS1

Classification

intergenic

Length

1978 nt

Genomic location

chr7-:77311382..77325742

Exon number

3

Exons

77311382..77313568,77314519..77314645,77325213..77325742

Genome context

Sequence
000001 GGAGAGTCCT CAAGATGGAT TTTCACAAAT CCTGCAGCGC ACTAACTGGG AGGAAGAAAC GATACAGAAA ATAAGAGTGT 000080
000081 CGGCCATCCC CCTCTCTGCA ACCGAAATTA CAGGCTCCAT TTCCTGTCCC CTTGGGAACT GCAAAATCCT CTGCTGAAAA 000160
000161 CCGGACGCCT CCCAGCCCCT CCAGGCCGGC GCACGCGGCC GCCGCGCTCC CCCTTCCCGG GCCCCGTGGG CGCCAGGGGG 000240
000241 CGGCGGGGAC CCACGGCGCC CTCCCCTCCC CCTCCCCGCA CGGCACCCAC CTCGGGGCAG CGGCTTCACC TCCCCGTTCT 000320
000321 CCTCCCGGGA GGCCCCGCCG GCCTCTCGGG CCCCACCGAG ACCGTGCCTC CTCCTCTCCT TCTCCCGCTT CTCCTTAGGT 000400
000401 CTGCGCGACT TGGCGTTAGC CGAGGCAGCG GCGGCGGCGG CGGGCAGGAG GAGATGGTGA GGCTGAGCGT GCAGCAGCGT 000480
000481 AGGAGGGACC AGCAGTTTGC GCGGCACCGG CTGAGACAAG GAAGCGGAGG CTGAGGAGGG AACGGCCGTG CCAGCGGAGA 000560
000561 AAGAGAAACT GCTCCGAGAA GAGGACGGGG AGGGAGCAGC AGACAGAGGG GCAAAGCTCC AAGACGCGGG GCTGCCATAG 000640
000641 CTCTGAGGCG AAGGTGCTGC CGGCGGCTGC AGCTGCCTGC TGTTCCCGCC GCTGCCCCCT TCTCCGTTCA CTCTCCGCGG 000720
000721 TGCCTTCTTC TCCTCAGTCC GGACCTTCTT GGCGGACAGA GAACCCGGAG GGTCCCGGGA GGAGAGTTGC AGCTTGCCAA 000800
000801 ACGGTTCTTT CTCCGAGACG GTGGCGGTGG GGGCCGCGGC AGCGACACAG TGCACGGGGC TCGGCGGTTC CGCCATTTTG 000880
000881 CGCTCCTGTT GTATTTACTC TCCTCCGCTA GCCGGCGCGG GGCAGGGGGC GGGCCCTCCG CGAGGGGTAG GGAAGGGGCG 000960
000961 GAGCGGCCAG GCCACCAGCC GGCATTGCTC CATTGGGCAA GCCACGCTGA GGGATCCACC TAAGAGCCAA TCAAAGGCAC 001040
001041 AAACATCAGA CGAAGGGGCG GGATCGCCAC AGGGACCCTC TTCGGAGGTC AGAGCTCGGC GGGGTGCGGC TAGTGGCGGA 001120
001121 GCGCGCTGCG AGGGGAGGGC TTTCCACTGT CGCTGGCGTG AACTCGCGTG CCCGGTGGGT ATCAGGGAAG AACCCCCGCC 001200
001201 CCGGACCCCC AGATCTGCCA TGGCCGAGGT AGCGATCGTC TCTGCGGCCA CGAAGACTGT TTTAACTTGT ACCACTTTCC 001280
001281 CTTCCATTTT TCCTGGGGTG CCTCTCACCC TGCATCTGCG CGTTCAGCAA GCTGGATTTC GGGAATGCTC AGTTCAGAAG 001360
001361 AGAAAAAATT GCCGGGAATC AAGTCCTTCT TTTTGTTAGT CGGTAGTCGA TTGATGGGAA GTGTTCAAAA TCATTCGATG 001440
001441 TGGTGACAAG GCTTCACCAG GTACTGCCTT CTAACGAGCT GGCCATTTCC ACATGTCAGA TAGGACCAAC TTGCCTTTTA 001520
001521 ACTACCCGTG TGATACTTAA ACACTGTTGC CGGTATCACA GCTTTTCTTC AAAACAGGAA GCAACGAGAA TGAGGGCATT 001600
001601 CCAGTAGCAG GAGACAGCAT GCATAGAGAT GCTGATGAAG AAAGAGCCTA GCGCACGTGG GAAACTGCAA AAGTTCAGAC 001680
001681 TGGTTGGAAT GCTGGAAATG TTGTGAATGA CAGGAGATGA GGCTGGCGAG AAAACAGAGG TCAGATTGTG GAAGGCTGTC 001760
001761 AAGCCAAAGA CTTTGATTTT ATTCTTGAGA TTGATGAGAT GTGTGTAATC CAGGAGTGTG CAAAACAATC TGTAAGGGTT 001840
001841 CAGAAAACAT ACTGCTTCTA TATATAGTTA CCTTTGTCTT AACTTGAAAA TTTCAAATTG TGTAGGAGTT ACAATGTGTG 001920
001921 TAATTGTTAT TATAGTACTG GATCCAAATA ATTTATAAAT AAATAAATAT AGACATAA
[back to top]
Please cite: Chunlei Yu, Lina Ma (2016) lncRNA: "NONHSAT121673" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT121673&oldid=1272241 (Last update: Jun 30, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu2.47136950.6682016-06-25 13:53:34[show]
Lina Ma2.08122490.9252016-06-29 17:09:25[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.101110112016-06-30 21:25:16[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox