NONHSAT099821

From LncRNAWiki
Jump to: navigation, search

DBET, a chromatin-associated noncoding RNA expressed selectively in facioscapulohumeral muscular dystrophy(FSHD) patients, directly recruits Trithorax group protein ASH1L to the FSHD locus to co-ordinate 4q35 gene de-repression[1]

Contents

Annotated Information

Name

DBET:D4Z4 binding element transcript(HGNC nomenclature)

"chromatin-associated long non-coding RNA", DBE-T, DUX4L30[1]

Cellular Localization

Proposed model of action of DBE-T lncRNA [1].

nuclear[1].

Function

DBET recruits the Trithorax group protein Ash1L to the FSHD locus, driving histone H3 lysine 36 dimethylation, chromatin remodeling, and 4q35 gene transcription[1].

Regulation

Ash1L promotes the expression of DBE-T, implying a positive feedback loop that would sustain 4q35 gene de-repression[1].

Diseases

  • Facioscapulohumeral muscular dystrophy (FSHD)[1]

Expression

DBET knockdown prevented 4q35 gene de-repression caused by AZA plus TSA, strongly suggesting a functional role for this transcript in the positive regulation of 4q35 gene expression[1]


shRNA Primer
DBE GCTCACCGCCATTCATGAAGG[1]
NDE GCTCACCGCCATTCATGAAGG[1]
Nonsilencing TCTCGCTTGGGCGAGAGTAAG[1]
Ash1L GCTGGTCATTTATTGCTCAAT[1]
Suz12 TTCTACAAACAGCATACAG[1]

Labs working on this lncRNA

Dulbecco Telethon Institute at San Raffaele Scientific Institute, Division of Regenerative Medicine, Stem Cells, and Gene Therapy, 20132 Milan, Italy

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Cabianca DS, Casa V, Bodega B, Xynos A, Ginelli E, Tanaka Y, et al. A long ncRNA links copy number variation to a polycomb/trithorax epigenetic switch in FSHD muscular dystrophy[J]. Cell. 2012,149(4):819-31.

Basic Information

Transcript ID

NONHSAT099821

Source

NONCODE4.0

Same with

DBE-T ,"chromatin-associated long non-coding RNA", DBET, DUX4L30

Classification

intergenic

Length

682 nt

Genomic location

chr4+:190986388..190987069

Exon number

1

Exons

190986388..190987069

Genome context

Sequence
000001 GCCTGGGGCT CTCCCACAGG GGGCTTTCGT GAGCCAGGCA GCGAGGGCCG CCCCCGCGCT GCAGCCCAGC CAGGCCGCGC 000080
000081 CGGCAGAGGG GATCTCCCAA CCTGCCCCGG CGCGCGGGGA TTTCGCCTAC GCCGCCCCGG CTCCTCCGGA GCCGGGGCGC 000160
000161 TCTCCCACCC TCAGGCTCCT CGGTGGCCTC CGCACCCGGG CAAAAGCCGG GAGGACCGGG ACCCGCAGCG CGACGGCCTG 000240
000241 CCGGGCCCCT GCGCGGTGGC ACAGCCTGGG CCCGCTCAAG CGGGGCCGCA GGGCCAAGGG GTGCTTGCGC CACCCACGTC 000320
000321 CCAGGGGAGT CCGTGGTGGG GCTGGGGCCG GGGTCCCCAG GTCGCCGGGG CGGCGTGGGA ACCCCAAGCC GGGGCAGCTC 000400
000401 CACCTCCCCA GCCCGCGCCC CCCGGACGCC TCCGCCTCCG CGCGGCAGGG GCAGATGCAA GGCATCCCGG CGCCCTCCCA 000480
000481 GGCGCTCCAG GAGCCGGCGC CCTGGTCTGC ACTCCCCTGC GGCCTGCTGC TGGATGAGCT CCTGGCGAGC CCGGAGTTTC 000560
000561 TGCAGCAGGC GCAACCTCTC CTAGAAACGG AGGCCCCGGG GGAGCTGGAG GCCTCGGAAG AGGCGCCTCG CTGGAAGCAC 000640
000641 CCCTCAGCGA GGAAGAATAC CGGGCTCTGC TGGAGGAGCT TT
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox