From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT096369" in LncRNAWiki, available at (Last update: Jun 25, 2016). [See details]

DANCR, an 855-base-pair lncRNA, suppressed differentiation.


Annotated Information


DANCR,differentiation antagonizing non-protein coding RNA(HGNC nomenclature)

"anti-differentiation ncRNA", "anti-differentiation noncoding RNA", lncRNA-ANCR[1]

KIAA0114, "KIAA0114"[2]

"small nucleolar RNA host gene 13 (non-protein coding)", SNHG13 "adipogenesis up-regulated transcript 2", AGU2[3]


The ANCR gene is located on human chromosome 4, with the closest adjacent annotated genes located 54.8 kb upstream of (USP46) and 28.7 kb downstream from (ERVMER34-1) the ANCR locus. The ANCR locus consists of three exons and harbors a microRNA (MIR4449) and a snoRNA (SNORA26) in introns 1 and 2, respectively. These small RNAs are not coordinately expressed with ANCR and are not part of the mature ANCR transcript). [1]

It contains another conserved GC-rich region in the first intron, which may be processed as a not-yet-annotated small functional RNA. This notion does, however, require more intensive analysis of the function of DANCR. From an evolutionary perspective, it is of interest that transcription units of DANCR as well as AGD2 are shaped by retrotransposons. AGU2 contains a long terminal repeat (LTR)-like element, which provides its polyA signal.[3]


ANCR regulates a global gene expression program associated with epidermal differentiation. [1].

ANCR suppresses a genetic program associated with epidermal differentiation. Depleting ANCR in progenitor-containing populations, without any other stimuli, led to rapid differentiation gene induction. In epidermis, ANCR loss abolished the normal exclusion of differentiation from the progenitor-containing compartment. The ANCR lncRNA is thus required to enforce the undifferentiated cell state within epidermis[1]


AGU2 induction seen in adipogenesis might be due to cooperative stimulation by Dex and IBMX.[3]


siControl(sense sequence) GUAGAUUCAUAUUGUAAGGUU[1]
shControl(sense sequence) GCTTCAATTCGCGCACCTA[1]
shANCR (sense sequence) GCGTACTAACTTGTAGCAA.[1]

Labs working on this lncRNA

Veterans Affairs Palo Alto Healthcare System, Palo Alto, California 94304, USA[1]

Kazusa DNA Research Institute, Chiba, Japan[2]

Center for Biological Resources and Informatics[3]


  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Kretz M, Webster DE, Flockhart RJ, Lee CS, Zehnder A, Lopez-Pajares V, et al. Suppression of progenitor differentiation requires the long noncoding RNA ANCR[J]. Genes & development. 2012,26(4):338-43.
  2. 2.0 2.1 Nagase T, Miyajima N, Tanaka A, Sazuka T, Seki N, Sato S, et al. Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1[J]. DNA research : an international journal for rapid publication of reports on genes and genomes. 1995,2(1):37-43.
  3. 3.0 3.1 3.2 3.3 Kikuchi K, Fukuda M, Ito T, Inoue M, Yokoi T, Chiku S, et al. Transcripts of unknown function in multiple-signaling pathways involved in human stem cell differentiation[J]. Nucleic acids research. 2009,37(15):4987-5000

Basic Information

Transcript ID




Same with

DANCR,ANCR,"anti-differentiation ncRNA", "anti-differentiation noncoding RNA", lncRNA-ANCR,KIAA0114, "KIAA0114","small nucleolar RNA host gene 13 (non-protein coding)", SNHG13 "adipogenesis up-regulated transcript 2", AGU2




878 nt

Genomic location


Exon number




Genome context

[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT096369" in LncRNAWiki, available at (Last update: Jun 25, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu3.5481354812016-06-25 14:18:48[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
