NONHSAT096369

From LncRNAWiki
Jump to: navigation, search

DANCR, an 855-base-pair lncRNA, suppressed differentiation.

Contents

Annotated Information

Name

DANCR,differentiation antagonizing non-protein coding RNA(HGNC nomenclature)

"anti-differentiation ncRNA", "anti-differentiation noncoding RNA", lncRNA-ANCR[1]

KIAA0114, "KIAA0114"[2]

"small nucleolar RNA host gene 13 (non-protein coding)", SNHG13 "adipogenesis up-regulated transcript 2", AGU2[3]

Characteristics

The ANCR gene is located on human chromosome 4, with the closest adjacent annotated genes located 54.8 kb upstream of (USP46) and 28.7 kb downstream from (ERVMER34-1) the ANCR locus. The ANCR locus consists of three exons and harbors a microRNA (MIR4449) and a snoRNA (SNORA26) in introns 1 and 2, respectively. These small RNAs are not coordinately expressed with ANCR and are not part of the mature ANCR transcript). [1]

It contains another conserved GC-rich region in the first intron, which may be processed as a not-yet-annotated small functional RNA. This notion does, however, require more intensive analysis of the function of DANCR. From an evolutionary perspective, it is of interest that transcription units of DANCR as well as AGD2 are shaped by retrotransposons. AGU2 contains a long terminal repeat (LTR)-like element, which provides its polyA signal.[3]

Function

ANCR regulates a global gene expression program associated with epidermal differentiation. [1].

ANCR suppresses a genetic program associated with epidermal differentiation. Depleting ANCR in progenitor-containing populations, without any other stimuli, led to rapid differentiation gene induction. In epidermis, ANCR loss abolished the normal exclusion of differentiation from the progenitor-containing compartment. The ANCR lncRNA is thus required to enforce the undifferentiated cell state within epidermis[1]

Regulation

AGU2 induction seen in adipogenesis might be due to cooperative stimulation by Dex and IBMX.[3]

Expression

siControl(sense sequence) GUAGAUUCAUAUUGUAAGGUU[1]
siANCR(sense sequence) GCAGGTATGTTCCTAGCCT[1]
shControl(sense sequence) GCTTCAATTCGCGCACCTA[1]
shANCR (sense sequence) GCGTACTAACTTGTAGCAA.[1]

Labs working on this lncRNA

Veterans Affairs Palo Alto Healthcare System, Palo Alto, California 94304, USA[1]

Kazusa DNA Research Institute, Chiba, Japan[2]

Center for Biological Resources and Informatics[3]


References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Kretz M, Webster DE, Flockhart RJ, Lee CS, Zehnder A, Lopez-Pajares V, et al. Suppression of progenitor differentiation requires the long noncoding RNA ANCR[J]. Genes & development. 2012,26(4):338-43.
  2. 2.0 2.1 Nagase T, Miyajima N, Tanaka A, Sazuka T, Seki N, Sato S, et al. Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1[J]. DNA research : an international journal for rapid publication of reports on genes and genomes. 1995,2(1):37-43.
  3. 3.0 3.1 3.2 3.3 Kikuchi K, Fukuda M, Ito T, Inoue M, Yokoi T, Chiku S, et al. Transcripts of unknown function in multiple-signaling pathways involved in human stem cell differentiation[J]. Nucleic acids research. 2009,37(15):4987-5000

Basic Information

Transcript ID

NONHSAT096369

Source

NONCODE4.0

Same with

DANCR,ANCR,"anti-differentiation ncRNA", "anti-differentiation noncoding RNA", lncRNA-ANCR,KIAA0114, "KIAA0114","small nucleolar RNA host gene 13 (non-protein coding)", SNHG13 "adipogenesis up-regulated transcript 2", AGU2

Classification

intergenic

Length

878 nt

Genomic location

chr4+:53578425..53580478

Exon number

3

Exons

53578425..53578694,53578991..53579126,53579661..53580478

Genome context

Sequence
000001 CCTCGCGACC CTCCTGCTTC CCTCCCCGCC CCGCGCCGCC TCTCTGGTTT GTGCGCCCGT CGCAGGTCGC AGGCCTCTTT 000080
000081 GTCAGCTGGA GTTGCGCGGG CTGACGCGCC ACTATGTAGC GGGTTTCGGG CGGGCCACGC GTGCGGGACA GGAACCCAAC 000160
000161 CCCAGCCGAC CTTGAGCTCC AGGAGTTCGT CTCTTACGTC TGCGGAAGTG CAGCTGCCTC AGTTCTTAGC GCAGGTTGAC 000240
000241 AACTACAGGC ACAAGCCATT GAAGCTGGAA TGTCCTGTTG CTGGTATTTC AATTGACTTA AGCCAACTAT CCCTTCAGTT 000320
000321 ACAATAGGAA AGTGCCTCTA ATAAGGCCAA ATATGCGTAC TAACTTGTAG CAACCACGTG TCCGTGCAGT GCCACAGGAG 000400
000401 CTAGAGCAGT GACAATGCTG GTGGCAACAG GGCAGTGTAG CAGGTGCTTC ATGTTCACCT TTTCAACCTT TTCATTTAAT 000480
000481 TGTCACAACT CGGAGGTGGA TTCTGTTAGG GACAGGCTGC CCCAGGACCA CTCCGCCCCC GCTAACTCAA TGCAGCTGAC 000560
000561 CCTTACCCTG AATACTCTGC AGCTGCATTC CTGAACCGTT ATCTAGGCGC TATAGCAAGG TCACCAGACT TGCTACACCG 000640
000641 AAGCCCTCTG GGTGGCACGG GGGAGGTCAT GAGAAACGTG GATTACACCC CCTTGTAAAT TCCTATTTTC ACAAGATAAT 000720
000721 ATATTGTAAG CCGGTCATGA GATTATATGT GGTAAAGTTA ATTGACTAAC AACCCCAGGG TCTCTCTCCC CCATATAAAC 000800
000801 CCCTCATTTT GTAAGCTCAG GGCTGCCACC TCCGACTGGT GGAGAAGCCT GGCAGGTTAA TAAACTTACT TGGCCTGA
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox