NONHSAT075852

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT075852" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT075852&oldid=1271824 (Last update: Jun 25, 2016). [See details]

SCHLAP1, spanning 1574 bp on 2q31.3, SChLAP1 contributes to the development of lethal cancer at least in part by antagonizing the tumor-suppressive functions of the SWI/SNF complex.

Contents

Annotated Information

Name

SCHLAP1:SWI/SNF complex antagonist associated with prostate cancer 1 (non-protein coding)(HGNC nomenclature)

PCAT11, "prostate cancer associated transcript 11", SChLAP1, "Second Chromosome Locus Associated with Prostate 1"[1]

Charateristics

SCHLAP1(SWI/SNF complex antagonist associated with prostate cancer 1)a 1,.4 kb, polyadenylated gene composed of up to seven exons and spanning nearly 200kb on Ch2q31.3, was located in the PCAT-114 region, which is located in a “gene desert” on Chromosome 2q31.3 and was expressed at higher levels in prostate cell lines[1].

Transcriptional start site (TSS) of SChLAP1 was marked by H3K4 trimethylation (H3K4me3) and its gene body harbored H3K36 trimethylation (H3K36me3)[1].

Cellular Localization

SChLAP1 transcripts were located in the nucleus[1].

Function

SChLAP1 contributes to the development of lethal cancer at least in part by antagonizing the tumor-suppressive functions of the SWI/SNF complex[1].

Diseases

  • prostate cancer[1]

Expression

Gene Purpose Sense Antisense
SChLAP-1 qPCR TGGACACAATTTCAAGTCCTCA CATGGTGAAAGTGCCTTATACA[1]
SChLAP-1 full length construct Molecular cloning GCTTTTATGAGCTGTAACACTCA ATTTATAAGTGAAAGAGGTTTA[1]
SChLAP-1 3' RACE TCAGAGGATAAACATGTGATAT[1] NA
SChLAP-1 3' RACE nested GATAAACATGTGATATGGTTTG[1] NA
SChLAP-1 3' RACE nested GTGTCCCCACCCAAATATCATCT[1] NA
SChLAP-1 5' RACE NA TTAGCCAGGACTTGATGGAAAT[1]
SChLAP-1 5' RACE nested NA TTCCAGGTACATGGTGAAAGTG[1]


Labs working on this lncRNA

  • Michigan Center for Translational Pathology, University of Michigan, Ann Arbor, Michigan, USA[1]

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Prensner JR, Iyer MK, Sahu A, Asangani IA, Cao Q, Patel L, et al. The long noncoding RNA SChLAP1 promotes aggressive prostate cancer and antagonizes the SWI/SNF complex[J]. Nature genetics. 2013,45(11):1392-8.</ref1>

Basic Information

Transcript ID

NONHSAT075852

Source

NONCODE4.0

Same with

SCHLAP1, PCAT11

Classification

intergenic

Length

12314 nt

Genomic location

chr2+:181762493..181785974

Exon number

3

Exons

181762493..181765038,181771313..181774666,181779561..181785974

Genome context

Sequence
000001 CATGCTTTTA TAGTTTATAA AACATGACCA TTTGTATCAG GCTCTATTTC AATGtttaaa acttaaaaga ttttttaaaa 000080
000081 gaatcaaata actaaaacaa attttaaaat aacattttta ttaaGTACCT CTGAGAATAA ATAGGTAGAA TTCATACAAA 000160
000161 GTCCAGCGAT TCAACAAATT AGTCTTCCGA GGTAGCAAAA AAAGTTTAAC TGTATCTACA AAAAAGAATT AGTAAGGTGA 000240
000241 AAGTTAACTT ATCAAAATCA GTTGTCAAAA CAAACTACTC AATAGTTACT TTAATTGCCT ATAGTGGAGA AAACCTTCAA 000320
000321 AGATTTAGAC TTATATATAT GACCCAAACA GCTTATTCAG GTGATATTTT AAACCTTAAG AATTAGATGT AAGTGTAAGT 000400
000401 AAAACTTAAG ATTTCATTTT TATTTACTAA CATTGCTCCT CTACAGGGAC AATTTCTCAC TTTCTCTGAA GGCACTGACA 000480
000481 CAGATTTTGG TGATTATTGC TGTATGCTGG GCCATATGTT ACACGGCAGA GTACAGCATG TGGCAGGCTA ATTTGTAGCA 000560
000561 ATGCAATTTT AGATTTTTGA CAATATACAC AATATATGAA AACTATCAAG TAACTGAATT TTACCCTGAT GAATTATCTA 000640
000641 TATATGTCAC TTCAAAACCC ACCCCCTAAA AACAGACTGC ATATAATATT ATTAAAAAGT AGTACAACTT ATGACTGTTA 000720
000721 AAATGTTATT CTCAATTTAT CATGCAAGAC CATATTCAGA TTCTGTTGCA CAGTCTTAAA ATTGCCAATT ACTGAAAAAA 000800
000801 ACCATCACAA TGGTAATTTT CCAACCATGA GAAAAGAACA ATATGAAAAT ACTCTACTGA AAATTGATGA AATTGAAGAG 000880
000881 AAAGGCCATT ATGAAAGTAA AACTTCCAAA TAAAATGCTT TCTTTCTTTA ATCAGTAATC TTCTTGAATG TATCATATAC 000960
000961 AGTTAGAATC ATTGCTTAGG CATCTACCAG GGCATTAGCG ATATCTGTGA ATTCTCTTTT AGGTGTAAAT TGTTGTTAAA 001040
001041 GTGAGGAAAA GAGATCAAAT GTTTGTTTCA CTCCAATATG ATAAAAATTC AATATTCAGT TTTAGAACTG ACGATCACAG 001120
001121 AGTTAGTATT AGCTAATCAT ACCATCACAT GCGCAGAGCT CTACTGTTCT ATAGTAGTCC ACCCTTGTCA AACTCTTTAA 001200
001201 AAATTCCCTG TTGGCATTGT GGCATGATTG ATAATGCCAG GAGGGAGTTT TTAAAGAGTT TGACAAGTAA TTTATAATTT 001280
001281 GAGGTAAGTT TTAGTTAATT TATACCCATA TATACACTAA AATAAATTTG CAACTCtcca tttatttaac aaagatttat 001360
001361 taagctcctt ttatgtgtta gtcatttctc tattcccaga cattcaattc aaccagataa atgtggagca gggaagacag 001440
001441 aattaaacaa ataattaTAA acttccagtc agccatgaca gattgaacac aatagtgtat ctctgctccc tcttgaaagg 001520
001521 ccactaaaat gacagtaaaa aatacacaaa ctcaccaaga taaagaaaat aggagagaac atacaacaga tagaaaaagt 001600
001601 caacaaaatt gagaaaaatg gaaaatagat ggctaattgg ccattagctt aggtttcagc cttctcccct ctgttgagtg 001680
001681 cttaggtagg gaggagaggc agatgctggg ggaagtgaaa gggagtgatg agaagataaa ccaattggta cctcagaatt 001760
001761 ccacaaaaag cctgggtaag gcactagcta tctctgatat cagacatgta aggtgaaact gaaggaaatt agatttattt 001840
001841 aaaatctgta taaaaaataa ttagacttct ctactctact ctagccaagt ggtttaattt ctggagatgg tgaacccaag 001920
001921 aggctctgct gggagacaac aaaaataatg aaggtaatgg atgaaatcct gtatgctcaa tgtaaaaata cttagctcct 002000
002001 ttcactttag ctgccagaac acttgtggtt ttatattcca tcagatggga agcttctctt ctctgaagaa tctggaaagt 002080
002081 atatgagaaa ggtgaggttg ccaaagaaat ggtttgtctc atccagtccc tcacagtgag tcccaacagt tggaaaattc 002160
002161 caccagtgaa tgcaaaaatt tcaatttgtc ttgtagtgtc tcacttttaa atatgaatga atggccaaaa atcaccagat 002240
002241 acaagtagag ggaatttcac ttcaaagaca aggccaaagc aaggaaataa gcaaatgaaa atgaaccatg cagggacttg 002320
002321 aagaaaattt gaagcaacta taaaaaatct cttcagagac acagcattta caaaacaaga atagaatgct tttttttttt 002400
002401 tttttttttt ttgagatgga gtcaggggtg caatctcagc tcactgcaac ctctaccttc caggttcaag tgattctcct 002480
002481 gccttggcct cccgagtagt tgggattgca gtcacccgcc accaagcctg gctaattttt ctatttTAAA AATCAACTGG 002560
002561 CTGTCAATCA AGTCAAAGAC TGGAAACTTT CTAAGGAAAA AGAAGCATTT GCAAACTGAA ATGAAGCACA AATCACTTCA 002640
002641 ATAGCTTAGA TTTGTGCTTT GAAAGTGTCA AACTAAACTA ATCACTGTAG GAATTGATGG AGTATTAGCT CTGGATTTCA 002720
002721 AGTTATTATA ATTTTTCAAT GTCTGTCTCA CATTTTTGGC TATCTGTCAG ATATAATTTC CTTGGAAATC CCATCCTCAG 002800
002801 CGTTGGTTCT CTGTTTAGAG CCTCAGGGGA ACTGCTATAA AAATGAATTA GTCCCATGAA AACAGACTAT TTATGGGTGT 002880
002881 TTTCTGCATG GTATTTGGAC TATAGAATAG ACATTCTGTA ACCTTGACTT GACAGGAGTA CAAAGTGGTA GATGCACAGT 002960
002961 GTTGGAGAAG GCAGTGAATA TAAACCTACA GAGATGATTC CGCATTGTTC CACCCATCCC AACCCCAACT CAAACATTGA 003040
003041 GAGGGAAACA TGGCTACTAT TTTCAGATTA CAAGAAAAAT AAATTTACTG CCTGCTCGTT TGGAGATCTA TAACCTTTAT 003120
003121 ACTTAGACAG TTTTTTAAAA AGTATAACAG CAATTATTTC TCCCAATTTA TTTAATGCCG TTTTTTCATT GCATCCATTA 003200
003201 AAATATTTTA CTTTTATAAG CAATGATACC AGGAAGTTAT CGTTTGAATA GTCTGCTGGA GGAGTAGGGC AAAGTAGTTA 003280
003281 AGATCAATTG TTCTTTCAGA AGGctgctgc tttctagctg catgactttg ggtacgttat ttaaccacta aacttcagtt 003360
003361 ctcctgtaaa ttggaaaaaa aaaaaaaaga caatgctgaa ttcaaataac tgaggataaa tgaggtaaag catattgaga 003440
003441 cttattatag ttcattatta ttgctttata caaatatgaA TTCTACAATG TGTACCTTCT GGTAAAAGTT GTGATGCCCT 003520
003521 ATTTTATTTT TTAAAGGTTT TCTTAAATTT ATGTAAACTT CCAATATCAT AAGTTGACAA CATGCCAGTT GGCCCTCAGA 003600
003601 TCTGTTTATT TATTGAATGA CTGCTCTCTG GTTTATAAAA CAGATATGTt ggaggttaca gtctagtaga gacagataat 003680
003681 aaacaaatat atatacatga aatgtgaaga aaataaccat ggtacagtgt atttctttaa agggtaatta cccatcataa 003760
003761 atggtccaag aaagattccc tagagaatta gcatttaagt taagagctga acgatggtgg tgtcagccat gtgactcatg 003840
003841 gaataagagg gttttatgca gCATGGTTAG GTATTGGTCA GAAGTCAGAC AGGAAATGGT TAAGCAGGAA TGCTCCTGAG 003920
003921 TTATTGCTTC TACAGAAAGG ATGTCTAATG GTGTTATACT GGAAGTAACA CAGTACTGAA CACTTTAAAA AAAAATGAGT 004000
004001 TGTATTGCAG CTTCCAGCCA GAAAGTTACT TTTCTTGCCA AAAAGGACAA TTATAAACTG TAACCCTCTC TAGAGATGAG 004080
004081 TGGAGAAGGC TGGGGTTGGA GGTGACTCAG TTAAAAGGAC CTGCAGGGTG ATCGGAGCTA GTCACCTGCA TTTTACAGAA 004160
004161 CATTTCAAAG GCAAGCAAAG CTTCAGGTTC AATCTGTTAA AGGTCAAACT TTTAGTGTAC AGAGCTGGAG AATGAGCTGA 004240
004241 AACAACGAAA CATCAAGCAG GGCAGCCTGC AAGAGCAAAA ATACTATGAA ATGCACAGAA AAGGAACTGA AGAACTTGGA 004320
004321 CAATTGAGAA GAAAAAATGT TTGACATACC CAGAGCACAG AATGTACTCT TGTCTGCAAT AATTATCACC CATTTGTAAG 004400
004401 AAGGAACTGG AAGCTAATGt cattaattca acaaatattt attgtattac atccccgtac aaagtaaaca aggaaacaaa 004480
004481 gatatttacc ctcaaggaac ttacattggg gttgggaggg ggtgggagag tacagggaaa acagatttgc attgtgttaa 004560
004561 acataataaa taagtaaatg acacagtgtg ttagaaaata cttagtgctc tggaaaaaaa gaaaagttga gtaagaaggg 004640
004641 gaagacaagg ctgggagaag gtagaagaga cagtttgcaa tattaaatgg ttgttcaagc caggcctgcc tcattgaaag 004720
004721 ggtgaaatct tccttcactg gaaggaagtg agagaattag tcaagcagct atctgaggaa agaacattcc aagtaaagAA 004800
004801 TATACAGCCC ATACATTGTT GGATGTGTGT ACATTGAAAT TTTTGTGCAG TAAAATGAAT ATTTCATTTA CCtatataat 004880
004881 tttacataaa ataaaatata ttttGAATGT GAGTTTGTTC CAAACAAATC ATTTTCTTGC CTTCAAAACC ACTGAGCTTA 004960
004961 AAGAACTCTT TCAAGTGTCA TTAGAGATAG ATTCCAACTA CAATCAACAT TGTGGAATCC AGAGGAGGCA AAATGAAGGA 005040
005041 AGCAGCACTC ATTACAAAAT GCTGCTTTGT AAAGAATTAA TTCTGTCCTG GTATGTTTCA CATTAGGTAA TATGAAGGAA 005120
005121 ATGAATATGT CATGAACCCT CCTTGAGGAT GTGGGGGAAT TAAAAGTAAT TTCGCTTAAT ATCCAACTCT CACTTTTGGC 005200
005201 TTTGTAGTCA GAGGGAAACA ATGCTTTCCC AGGTTCTAAG GTAAACGTTA AAAGGTTACA AGGAGACTTG GAAGAGTCAA 005280
005281 GGAACGCTTC CACCAACTAT TCCTGCCATT CCAGTTGGGA GGGTTGTCTG AGGGGAAGTG AAAAATAGTT TATTACTTAC 005360
005361 TATATTTTTG GTACAAGATC TGTTATATTT TTCTAGATTA AAAACAATTC AGTGAACACT GATCCTTTAA AAAAAAGAAC 005440
005441 TCGAGGTTTA TAAAATGCCT CTAAGGTGGG GGAGTGGGTT AGTGGTAAGA AAAGcaaaac tgtgatgcaa ttgttgaaaa 005520
005521 agccaattat taaggcatca ttcatggaac tataatacct gatcctaaaa gtaatatatc cattatactt tgcctcagtt 005600
005601 ctatatgtct aactcatcaa gttaatttct gagagctgca tttcttaaaa gagatgttaa aggtcaggag atcgagacta 005680
005681 tcctggctaa cacagtgaaa ccccgtctct actaaaaata cgaaaaaaaa aaaaatagcc aggtgtggtg gcacacgcct 005760
005761 gtagtcccag ctactcggga ggctgaggta ggagaatcac ttgaacctgg gaggcagagg ttgcagtgag ctgtgatcgc 005840
005841 gccactgcac tccgtcctgg gtgacagagc aagacgccgt ctcaaaaaaa aaaaaaaaaa aattttgagt gcaatatttt 005920
005921 agaaaatcaa aatgagtacc ctaaagaacc atgatgaaca tggaatcaaa atgtaaataa gaaataaaat cagtatgact 006000
006001 gatttttttt cttttactcc tgttgctaat atagctcagc acagcactgt tactgattat tccttattta aaatgttgat 006080
006081 atttttctca tcatggactt tttacattaa ctttgTAAAT GAGAATTAAA ATAAAGAAAT TTTTCTGGCT TCTGCAAAGG 006160
006161 AGATAGGTGC TCAGCGAGTG GCGTAGATAA GTGATGCAAA ATATGAGTTG GTATTATCCA CCCTTCCAAA CTAATCAATT 006240
006241 ATTCTACCAA ATGTCAGAAA TATGTATGTG AATGTTATCA TTTCAACAGT GCTGAACACA TCCCAGCCAT TAATGCTAGG 006320
006321 TATCAGCTTC ATTTTCATCT ATTTGCTTAG CATTTGGTGC TTAATGTAGT GTAGTCTACA GCAACTCTAG TCTGGAACAC 006400
006401 TACAGAACAA ATTGACAATT TGAACCAAAA CTGCTGCAAA GGAAATAATG ATCTAGTGCA CCACTGTGGA AAGTCTCCAA 006480
006481 AACAGTGGAG GGGAAAATCT TTTCGATATA GCCTCTCTTT CAGATAATTT GAATGCACTT TGACAGAACT TGATAATGAA 006560
006561 CGTGGgtggt acactcagag atgctctgcc agaattcctt caaggaagta cttactgccc agccatgggg aggacagtca 006640
006641 ggaggcaacc cagcgatcag caacttcagg gtccacctca gctgtaagga gccacctctc cagagatctc acccttctca 006720
006721 aggcagactg cagctgctga ctaagcaagg cagtgtttga aaggccccat cactctaaag cacaatattc ccttcattgc 006800
006801 tcctgctgaa ttggtcaaag atttgttggc ctgcattcca gttcaacttt tttctctacc cagtcctgct tcctgtcctt 006880
006881 cctttccCAT CTTACCCTCC AAAACTCATC TAAATAAGCA TCTGCTCCCA GAAAACCCAA CCTGAGACAG GGAGTTAAAC 006960
006961 TTCCCAACGT TTTTCTTTTT ACAGTATTAT TTAGAATAAC AACAAAAAAG TATGCAAAAA AGACTAAATA TCCAACTGTA 007040
007041 TTTGCAACAT ATATTTTTGA GCTTTCTCAG TTTAGATCTG AATTATATAG TTATAATGAT TTTGGATTCA GTTTTTTGGT 007120
007121 TGACATTATT TAACATACAA TTCCTCAGAG CAACTTTGTC GAGATATTTC TCTTCTGCAA TGCCCTTACA GTATTCTATA 007200
007201 GTGGATTTCT TAACTGTCTC CAAATGTATG GCCTTACATT GTTTACTATT TTTTCACTCC TTGAAATAGT GTTATAATAT 007280
007281 TTATGTACAA ATTGCTTTCT TTCCCTTTTG ATTAATTCCT TCAACAATTG CCTTCCTAGA ATTGAACCAG AGTCCGGTGA 007360
007361 ATATCAGCAC TGGGACCAGT TAGCAGAGGA AAAGGAAAGA ATAAAAGCGA AAAGAATGAA GAGTCATATG ATTACCAACT 007440
007441 TTTCCTTTTT CATATAAATT GAGTGTATAT GGGTCTGGAA CAACCTGAAT TTCCATCAAG TCCTGGCTAA CCTCATTATG 007520
007521 TCCTATGAAT ATTTTTGACT AATCCCACTT TACATTAATC TGTATTGTGA ATGTGGATAT TGAATTATAT TTCTTTGTAA 007600
007601 TCCCATTATC CAAAATCCAG TTCAGAGACT ATTAGTTACC AATGTTCACT GTGAAGGAAA AAAAAAAAAA AAAAGCTCAG 007680
007681 AGGATAAACA TGtgatatgg tttggctgtg tccccaccca aatatcatct tgaattgtag ctcccataat tcccacgtgt 007760
007761 tgtgggaggg acccggtggg agataattgt atcatggggg tggttccccc atactattct catagtagtg aataagtctc 007840
007841 acaaaatctg atggttttat gagggaaaac ccctttcacc tggttctcat tctcttctct ggtctgtcgt catgtaagac 007920
007921 atgcctttca ccttctccac catgactgtg aggcctcccc agccacgtgg aactgtgagc ccattaaacc tctttcactt 008000
008001 ataaattacc cagtctctgg tatatcttta tcagcagcat gaaaacagac tagtacaACA TGTTTGGAAA TGATGTTCAG 008080
008081 AATTAAATTT TCTTCTTGAA GAATAATAAT GTACAGGAGT GTGTTGAAGA TTTTGAGAAT TCTCACAGCA AAGGAACTTG 008160
008161 TTAATTTTTT TAATCCACCT ACCTAATAGA ATTAATATTT TAAGAGAAAC AGCTTGTGAA ACAATTATAT ATATGGTCCC 008240
008241 ATAAAAACTT TTAGAAAACA ATTATTATAC ACACATATAA ACACATATTA CTTACTAGTA AAGATGTACC TATCTTCCTA 008320
008321 GGAAGCTCTT TCATGGTATT TCATTAGTAT CCCTTCCAGC ACCTACCATC CATCCAGGCA AATTTTAGAT GTTTTACAAA 008400
008401 GGTTTATGAA ATTGCATTAA ACACCTGTTA AAAATCACTT TGTTCATTGC AAGACATTTA TATACTGTAG TTTTAAAGAA 008480
008481 AGATAACAGC TGAGGGGAGC TACAGGAAAA AGAAAAGCAT AGAACTTATG TTGAATTATT TTTCTTGTGC ATATGAAGTT 008560
008561 GCTCTGTGAG AACAAGAGCA CTCAGCAGAC GTATAGATCC ACTATCTTTT CACATGGCAA TATGTTCATC CTTTCAGACA 008640
008641 ATTTGAGCAA GTTTGGAACA TAAAATAATA CAAAGAGGCT AAAATGCAAA GCAAAAAAAA AAAAATGAAA ATGATTGGCA 008720
008721 CAAAATAATG GAGCAATTGT AAGAGATGTT ACATGTGTAA ACTTAAACCA GGACATAAAC CGTTGAAGTT CACCGTTTAA 008800
008801 GGAAGCATCC AAATATATAA TAGTCCTGCT AAATGCTTGG AGTAGCAAAT TTCTATCACA TGCATCCACA TGCACATCTT 008880
008881 ACATTAAAAT CCCGTGACAA TAGTGTTAAC ATCTTGTCAT TTTAGCCTTG AATGTCAAAG GCTCATGGGA TCTACTCCAT 008960
008961 GACTCACATA ACCTGTATAT CTAGAAACAG GTGTTTTAAA CTCTACATCT GGTGATAAAT ATTAAAGATA GAAGATGAGA 009040
009041 GTTCTAAAAC AGTCTACTTA TTTCATTTCC ACTTGGCTTT GCCACCATTA CCTAAACTAT TACAGATTGA GCTCCACAGA 009120
009121 CTACTCAGAA TTCTCCTCCT GTCTTGAAAT TCCAAATGCA ATTTTCCCAG GATTTTTAGA AATTTATGAA ATTATTAGCC 009200
009201 AAAAATATTA TATTTCAAGA TTAAGccctc atcctacagt ttagaaaacc aagagccagc tgaaaatact tgctcaaatt 009280
009281 cagagaatga atGTTGTCTA AATTAGTTCA AAAACAAGTG ACTCATTGAA GATAAAGTAG TGTGGTGATT AAAAGCATGT 009360
009361 ACTTTGAAAA AAAAAAAAGT GACTCTTGGC TTGTAATACA ATTTTTTCAC TGCATTATTC TAAGGAAATT TGTTAGTAGA 009440
009441 GCTGAAATAA TACAGCATTA GGGTTAAAAA GTACAAGTTT CAAAGTTACA AAGACCAAGG TAGCGAAAgg caaattactc 009520
009521 aacctctcta aacatggttt attcattagt aaaagaagaa caagaatatt atttatgaca tagtattaag agttttaaac 009600
009601 aatgtagaat actgaaagtg ccaaaaaact attgtcatta ttacatatgt aagTAAAATT TATTTTCTGC ATATCATtgt 009680
009681 attagtctgt tttcatactg ctacaaggaa ctacccaagc aggtaatttg taaagaaaag aggtttaatt gacacacagt 009760
009761 tcagcatggc tcggggggcg ggggggccct caggaaactt acaatcatga tggaaggcaa agggggagca aggcaccttc 009840
009841 ttcacgaggc ggcaggaagg agaaatgctg agtgaaaggg gaagagcccc ttataaaacc atcagatcta gtgagaactc 009920
009921 actatcatga gaaccgcatg gaagaaactg cttctgtgat tcagttatct ccacttggtc tctcccttga cacacgacga 010000
010001 attacaattc aagatgactt ttgggtggag acacaaagcc taaccatatc aATCACCATA CCTTTCAAAA ACTACAAATA 010080
010081 GTTTTCATTA CATTTGGAGG TCAGTCTCAT GTAAATTATA ATGAGGTATC ATATTCAAAA TCCACTTTga tctctgcttc 010160
010161 taagaggacg gagtggacat aatttccgta ttcctcccaa tgggcacaac taaaaactct ggaaatgata tataaaacaa 010240
010241 atgtaagaag actctaaagc atggaaagaa aaaggcaggc gagcttggga aattggaatt caatgaacta cacagtgctg 010320
010321 agttccctga gttttcatct tgcctcacat atcatctcag actgggcact aaagacatca acaacccgaa aatactaaaa 010400
010401 cgctaatgga cacaaacacc aaaacacaca catacacaca caaataaaaa cccaagagaa gcctgctttc tcttgccaat 010480
010481 ggaccagaaa agaagcagca taggaagaca gaaaacattt agacaataac cactttactc tagccaaaca ctatgtaaaa 010560
010561 tactgcatgc ctacccctag aagcaaaggc agaggggaga gtccagtctt tggactcttg ccaggctgcc aggaggtgct 010640
010641 gcaagcccta cctacctcca gagtggtgtc agagaaggca gagtggaaag ctgagaccat catccctatc aggtggtaaa 010720
010721 gaggatcccc ttcagggtgt caggggagtc catgggaaga gggataggga cttggatttc caccctaccc agaggcacca 010800
010801 aggcacccac actcctctca ctgaggtgct gtcagaggag gtctaatgga gagtcggtac tttaatgtgg ctcagtggta 010880
010881 acaagctcga ccccaaaagt gctagtagag gccatgtggg aagctgtaag aagacatccc tcccctccca gccagggtgg 010960
010961 tatcaacaga tacctaatgg ggaactgagt tttgaccaaa gtgcaaaagc aattcaatgg aggaacaaac ttttcaataa 011040
011041 atggtgctga agcaattgga tacctatagg caaaaaaata aaaataaaaa aaaattagac ctcaaacgtt taacaaaaat 011120
011121 taactcaaaa taaatagtat atttaatata aaatgtaaac tacaaaactt acaaaataac attggagaaa attttcagga 011200
011201 cctaggactt ggtgaagaaa atgtagatgt gacaccaaaa gcacaatcca tacgagtaaa aaatcaataa attggatcta 011280
011281 cttttgctct gtgaaagatc ctgtttaaga gaatgaaaag acaagctata gagtgggaga aaatatttgc aaatatcagt 011360
011361 gagatttctt aaaattgaac agttaaaaac aaataaccca attagaaaat gggccttccc cacccccaaa aaacccatga 011440
011441 agagacattt cagacatgta agcaaatgaa aaaatgttca aagtcactag ctattaggga aatgcaaata aagaccatga 011520
011521 ggagacatca ctacatacct ttcaacatgc tgacataaaa aaaacggtga caacaccaga tgctagcaag gatacagaga 011600
011601 aacttgatgt ctcatacatt gccagtggga atacaaaatg gttaagccac tgtggaaaac agtttggctg tttcttaaag 011680
011681 taattaaaca tatgcttacc atacaaccca gaaattgtac tccagggcat ttatcccaga gaaatgaaac attattgtag 011760
011761 cagttttttg ttgttgttgt tatagccaaa acctggaata cagcaataaa aaggaataaa ctattaatac acaccatgat 011840
011841 ttggatggat ttcaaagtca ttacaataag tgaaaaaaaa tctcagagga cacatttata tgtgagctca tttatacaac 011920
011921 attcttgaaa tgataaaatt acagagacag gaaaaaaaaa ttatgtttcc catgagttag ggatggtata ggcgaggaaa 012000
012001 ttgagtgcag ctataaaggg gtaatttgag ggagatcttt gtggtaaagg aatagttctg tatcttgatt gtactgatga 012080
012081 tatagactga tgaatctaca catatgataa aatgacatgg aatcatatat actcattgtc taatttctgt ctttgatgct 012160
012161 gtattatagt tatataagat gtatccattg atggaaactg agagaagagt acgtgggttg tctctgtgct acttttgcaa 012240
012241 cttcctgtga atctacaatt attttaaaat aaaatttttc tttttttatt atactttaag ttctagggta catg
[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT075852" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT075852&oldid=1271824 (Last update: Jun 25, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu2.131213012016-06-25 14:36:46[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox