NONHSAT028496

From LncRNAWiki
Jump to: navigation, search

CISTR, embedded in a cis-regulatory element(CRE), which interacts in cis with PTHLH expression and simultaneously in trans with sex-determing region Y-box9(SOX9), may cause brachydactyly type E(BDE) when occurring translocation-mediated genomic disruption.

Contents

Annotated Information

Name

CISTR:chondrogenesis-associated transcript (HGNC nomenclature)

"cis- and trans-chromosomal chondrogenic regulator transcript", CISTR-ACT, CISTRACT, re52431[1]

Function

DA125942 transcription and dependent regulation of SOX9, DA125942, and PTHLH. [1].

CISTR silencing led to PTHLH or SOX9 repressions in humans and rodents, whereas their altered expression coincided with lncRNA dysregulation.[1]

CISTR gene may mediate the HOXB cluster, ETV4, NOG, and SOX9 were all located on chromosome 17 which indicated lncRNA can enhance and specifically influence gene regulation in cis over several Mb[1].

Regulation

Knocking down PTHLH and SOX9 significantly increased CISTR expression by 4- and 6.8-fold,respectively.[1]

Expression

In the BDE patients, the CISTR occupancy at the PTHLH locus was reduced.

siRNA sense antisense
siRNA 1 GCACAUGACCACAUGGAAATT UUUCCAUGUGGUCAUGUGCGA [1]
siRNA 2 GUUUCUCUCAGCAAAUUCATT UGAAUUUGCUGAGAGAAACTG [1]
siRNA 3 CAAGGACACUGAAAAAGCUTT AGCUUUUUCAGUGUCCUUGAG [1]

Labs working on this lncRNA

Experimental and Clinical Research Center (ECRC), a joint cooperation between the Charité Medical Faculty and the Max Delbrück Center for Molecular Medicine (MDC), Berlin, Germany.

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Maass PG, Rump A, Schulz H, Stricker S, Schulze L, Platzer K, et al. A misplaced lncRNA causes brachydactyly in humans[J]. The Journal of clinical investigation. 2012,122(11):3990-4002.

Basic Information

Transcript ID

NONHSAT028496

Source

NONCODE4.0

Same with

,

Classification

intergenic

Length

772 nt

Genomic location

chr12-:54144081..54145660

Exon number

2

Exons

54144081..54144749,54145558..54145660

Genome context

Sequence
000001 gggaggaaaa gaggcgggag agagaCCCTA AAAAGCAAGC TAGACTCTCC AGCCGGCCGC TCTGGTGTGG GGAGGGAGCG 000080
000081 TCATCTCAAG GACACTGAAA AAGCTGTTTG CCGTTTTGCT GTTTGCCTCC TTGTCACGAC CTCAGCGACG GCAGATGGAG 000160
000161 CCAGTGGAGG GAGAGAGACA GACGGCAATG CTTGGGTAGC CAGGGCTCCC TGCCGGCCCC ACTCCTCCTG CAGACACGAG 000240
000241 CACGCACACA CACACGCGCG CAAAACACAC ACGCTGCCCT TCGCCACACG TAGCCAAGTA AAATACACAA AAAGCAACTG 000320
000321 AGATACCATT CGCACATGAC CACATGGAAA CACACAAATG AACAAACGCA TTCAGGCATA GCCACATGCC AGTCACACAG 000400
000401 ATGGATAGAC AAGAGCCTGG GGTACAAAGC CACATGGCAC AAAGCCACCT GGATGTATAT GCCCCTacac acgcacacag 000480
000481 aaaaaaacat gcaaacttaa gtacacacct atccagacaa gtgtgagtgc acacacacac acactcacac acTCTACCTG 000560
000561 ACACGTTAGT GCATCCCCAT TGGGCCCCAG TTTCTCTCAG CAAATTCAGA TCACCCAGCC TGACTTCAAA ACCTGCCCCC 000640
000641 TTCCATTCCC CTTCATGCTG GTTCCTGAAT CCAGCTCGTT GCTCCAGGCT AGCAAAGCTG TCCACAGCCT CATTTGTGGT 000720
000721 TTGCTCACCT GCCTCAGCAC CATCAGCCAG AGGTACTCCT GCTCTTCTCC TA
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox