NONHSAT018635

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT018635" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT018635&oldid=1272104 (Last update: Jun 30, 2016). [See details]

PAUPAR, a vertebrate-conserved and central nervous system-expressed lncRNA transcribed from a locus upstream of the gene encoding the PAX6 transcription factor, acts in a transcript-dependent manner both locally, to regulate Pax6, as well as distally by binding and regulating genes on multiple chromosomes, in part through physical association with PAX6 protein.

Contents

Annotated Information

Name

PAUPAR:PAX6 upstream antisense RNA(HGNC nomenclature)

Function

Paupar acts in a transcript-dependent manner both locally, to regulate Pax6, as well as distally by binding and regulating genes on multiple chromosomes, in part through physical association with PAX6 protein[1].

Paupar binding sites are enriched near promoters and can function as transcriptional regulatory elements whose activity is modulated by Paupar transcript levels[1].

Paupar can function in trans at transcriptional regulatory elements distinct from its site of synthesis to control large-scale transcriptional programmes[1].

Expression

Conservation and expression of Paupar[1].

qPCR Primers are as follows,

qPCR Primers Forward Reverse
Paupar accatcacccctgcaatagttc agcagcctttgagccatctc[1]
Pax6 caccgccctcaccaacac tgcataggcaggttgtttgc[1]
GAPDH tgtgtccgtcgtggatctga cctgcttcaccaccttcttga[1]
Idh1 agaaaatgtggaagagccctaacg tgccagctcgatctaccacaaaat[1]
TBP tcagttctggaaaaatggtgtg tgctgctagtctggattgttct[1]
Pax6OS1 gctgagatctgtggctgaaagg agtccccaggcttgtctaagg[1]
Malat1 cgtttgaaggcatgagttg tgcctcccaagtgctaggat[1]
Tubb3 gcgcatcagcgtatactacaa ttccaagtccaccagaatgg[1]

Evolutionary

Paupar transcripts are known from dog, as well as from more distantly related vertebrates, frog and zebrafish. Paupar is unusual in exhibiting higher degrees of sequence and transcriptional conservation than most lncRNA loci[1]

Labs working on this lncRNA

  • MRC Functional Genomics Unit, University of Oxford, Oxford UK[1].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Vance KW, Sansom SN, Lee S, Chalei V, Kong L, Cooper SE, et al. The long non-coding RNA Paupar regulates the expression of both local and distal genes[J]. The EMBO journal. 2014,33(4):296-311.

Basic Information

Transcript ID

NONHSAT018635

Source

NONCODE4.0

Same with

PAUPAR,

Classification

antisense

Length

17909 nt

Genomic location

chr11+:31840694..31858602

Exon number

1

Exons

31840694..31858602

Genome context

Sequence
000001 TGCGCGCCTT GATCCGGGCG GCGGCTAAGG GAGAGCCGAG CACAGATGGC GCCGAGGCGG AGGTCTAGTG ATTCCCGCTC 000080
000081 CCGCCCCTGG CACACCTGGA CAGGTGCCGG GCCTCGCAAC CGGCCAGGAG GCAGCTCCAG GCAGCCCGTC TGCCCACTCC 000160
000161 TCTTAGCCCG GACAGCTCCT AGCTGGACTT GATTTTTTGT CTTGCTCAGC CCGTCGAGGA CTGGAGGGCA GAgtaggggt 000240
000241 gggagtgggg gtaggggtag aggtgggggt ggcggtgaag gtggggAGGA GAATGGGAGC TTTGGCTGAG AAGTTTCCGC 000320
000321 AGGATGTTCT TACTTATTTA CAAACATTCT CCAAACTTTC TTTCTTCTTC CTAACGCCCT GGGCATCCTG TGTTAAGGCC 000400
000401 TAGGAGCGCC CACCTCCCAC TGGCCACTCT AGTCTGGGCC TAGACCTTAC CATGGTCCTG TCGCCCTGCT CGGCTGGGAA 000480
000481 GGGATGCTAA GAGAGGCATT TGTTCTGGTT TCCCTGTCGC CGTCGGCCAT CTCCAGTGAC CTAGTTTCTT GGTAAGCCCC 000560
000561 TAGCTCCCCT CCAGGACCTG GCCCAGCCTC CAGCCTCAGA TGTCCTGAGG TCTCCCAGAC TCCGCCGTCC GCCTTGGCGT 000640
000641 GTGGGCTGCG GATAGGCCTC GGACCTGTGT AGGCCTTCCT AGCTGGCCAG TTTCTGTCCG GGTCTCGCTC CCCACACTGT 000720
000721 ACCAACCCTA GGCCGCCGAG AGGGCTGTTA TGGGCTTGTT TGGAGTCCAG GCCATTAAGT GTGCGCAAAT CCCTGCAACC 000800
000801 CAGCAGGGTG CTCGAGAGCG ACTCTGGAAA CGCCACGGCC CCCGCCTGCT TATCTGCCTG TCAATAAAGG GCGCGTTCGG 000880
000881 GCTGCGCGGG AGCGCCGGTG GTGCAGGCGA GGCCCGAACT AGGCCCTTCC GAGCTCCGGG CCAACGCACG AGCCGCTCTC 000960
000961 CATTTGTCCC GGGCAAGGAG GCTGGGAGGG AGGGAGCCGG CTCTGGGGTC GCCGAGGGAG AAGGTGCGGG TTTAGCCGCT 001040
001041 GCCTCAGCTG GATTCTTGGA GAAGCGCTCG ACCTCGGAGC ACTCTGGAGA CCCTACCAGA AATCTAGTGC TGGGGGCTCC 001120
001121 TCTCCGCGCC TGCCACCAGC CTTGGAGGAA GCTGGGCAGG GCCCCGTGTG GTGCCCAGCC TACGAGGTCC CACCTCGCCT 001200
001201 CTCCCTGGCA GAGGCATCCT CTCTAGGCCA CACTGGCTCG CATTGCGGGA AGAAGGGCAC CGCGGGCGGC CCGGGGGCAT 001280
001281 CATCGACGAC TCGTAGAGCC CCAAATGCCG AGTGCTACCT GAGGCAGGCT GTAGCTGGGG TGAAAAGGAC CGGAAGCGGG 001360
001361 AAAGAAACCT CTTTTCTTTC AGGCCTCCCT TCAGCCCGGG GTAGCACAGA CTGCAAATTT CCGACACCTA GGGCAGCTCC 001440
001441 AGGCTCTGAT TCTCCACCGC ACAGTGAGCG AGCTCGGCAG CCGCCCAGTC TGCGTAGGCT CCCAGGCCAG CCCCGGCCCC 001520
001521 AGAGCTTCCC CATCAGCCAG CAGAGGCTGG GTGGAGAGCC TGGATGGGCG TGAGAGGCCT TGAAGTAGGG GAAGTAGTGG 001600
001601 AGAGAGAGAA AGATAGAGAA ATCGGCTCTT GGCTTGAACT GTTGTTCTTG TCGAAGGTAT GTTTTCCCCT CCCGGCCTCT 001680
001681 GTCGCTTTTC CTCTCTCCCC TTAACTACTT TATGCAAATA AAGCCGCTTC CAGACTGGAG GAGCCCCTAC CGCTGGATCT 001760
001761 GTGCTACCAG GTGGGTGGGA ATTGATTTAG TATTTGCCTT TTTATTGAGA ATAGGCACTG AGTCTCCCAC CAATTATAAA 001840
001841 ATAAAAATGG ATTTTCCTCT TAAAATTTAA TTTTACTCAA TCTGGAAGAT AATGCATCCT GTTAATTTCT ACAATATTTT 001920
001921 TAAAAAAGGA TTCCAGGGTG AGCGCTAACT TATAAAATGG TTTAATAAAG CTTTTCCATA TACAAATTAA TAGGAGAGGA 002000
002001 AAAAGCCCCT AAATAATTGA TTTAAAATAC TGTGTATTAT TTGAGTGTCA TTTCAAATAG CTGTACAAGC CAGTAATCAA 002080
002081 TATATCATCT AAGGAATCTA ATTTACTGGG CAGTACGTGT GGCTCTTGCT CTTCCTTCCC TCTCCACTTC CTCCCCTTTA 002160
002161 AACAGAAAAC TTGTTTTAAC AAGATTTTTA TTTTAAATCA AAATTGAAGG AAAGTTTTGT GAATTCGAGC GTCAAAAAGG 002240
002241 GGACTATTTA GCAAAGATAA TATTTGCCAT CTCTTCACCC CGGTCTCAAG GATTGCATAA TGGCATGATT ATGTGCAATT 002320
002321 CTGTGTTTTC TCTGCTATTA ATTTATTTTC CTGCTCTCAT TTAAATAACT ACTTTACTTT TTTCTCTCTT CTATTTTGCC 002400
002401 ACACCATAAA AAGTTTTCCC GGACCTCTGT GGAAAATCTC CAATCCTTCC AGTTAGCTTT GTCacaaaca aacaaacaaa 002480
002481 caaaaaacaa acaaacaaac aaaacaaaac aaaaaacTCT ACAACAATCA ATTTGAGAAA ACTCTGCTTT TTCTTTCCTT 002560
002561 TTAAACATTT TCATATTAAG TCAGTTTGTG GCACCATGTT TGATTTCTTT CTCTCCCTTG TCCGGGTAGA GATGGAGACA 002640
002641 TTAGCTGAAT TCCCTGGGGG TGATTGGATG CAATTCACTG AAAGTAGACA GGCACGTCCT GGATGTTAGA AATTCACTTT 002720
002721 TTCTCAACGT GACAAGGCCG GCTTCGATCT ACAATTGTAT TTGAATGGGC AATGAGCGGA AAGATCTCTC ATCATTAAGC 002800
002801 TTGCTTCTAC TTTAGCAAAA TAAGGAGAGC CTTCATTTGC ACACAAATGC TCATAAAACT CGGATTCCCT GCAACCCTTT 002880
002881 AATAAAAAAG GATTGCTGCA TAATTTAAAT TGGAGGCCAG GGGAAGGCTG AGAGAGGGAG ATGAGGGGGT TTCAACTGAG 002960
002961 TCCCCTCCCT TCCCCCAAAA GGTCCATGTG ATCGAGTTGA CTTTTTTACT TTAAATCTTA AATAAGATGT GAGTTGTAAC 003040
003041 AAGAGGATTG GCACTTACTC CGTGACCCTT ATAATTGGAT TAAATATAGA CTGAGACGTA CAAAAACACA CCAAGATTGA 003120
003121 CACCTGCCAA CTGGACTTCC TTATGATTGA TTGTGATGCT TCGTGCTGGC AACAATAATG AAATAAATTG TACGGATAAA 003200
003201 ACAGCACATT TGTCATTTCC GTGCCATGAG TGAGGAAGTC AACGAGTTAG GCAAGCTGTT AGCTGACAGG CGCGAGCGGG 003280
003281 AGGCAAGCTA AAGAGATAAA TAAGGATTCC AGGCATTGAC AGGACAAATT ATAACTTGTC ACAACCTTTT TAAATTCAGA 003360
003361 AGTTTTCAAT TAACATATAT ATTGCTGTTA CATATAAGAT AAGGGGGCAC TGACGTAAAC ACGCGTGGGG TGCAGGGACC 003440
003441 CCCCCCCCCA GTGCCAAGGG TTTGGGCATC CGGGCTTGGG CATCCAGGCC TCTCTGGCTC TGTTCTCCCA TTCTGGCAAG 003520
003521 CCGGAGGGCA CCCAGGTTTG CATGGCCAGC CTGTAGGCCC GGGGCTCCGT AAGGTGGGTG AGAGTGTGAT AGGCTAAGTG 003600
003601 CAGCTGCTTC TTTTGCTAGG AGCCCCAGTT CACAGGTCCA GCACCCTTTC TTCATGGAAG CAAAGCTCCC AGATCAAGGG 003680
003681 AGAGGCTGGG CGAGGCCTGG GCCCAGGTCT GGAAGGACAA GTCCTGCTCT GTCTCCTGGA GTCCTATGTA AGGAGTAAGA 003760
003761 GATAGAGGGC AGAGGCTCCC CCTTTTGCGC TCCAATGTCT TGCCCTCATA GGAAAATCTG AGCTGCTGGA CACAACATAT 003840
003841 CAACAATGGC CACATCCTGT GGGCAGGCCT AGGCCACTGA AACCTGGTGT GGCCTGAGGC TGCTCCTGAG CTCTCAACTC 003920
003921 CTTCTCTGAC TCACCGGCCC AGTGCCGCCA AGGAACCGGT CCTGTGTCCT ACCTAGGAAG AGCTGCTTTT CCCTCCTCAG 004000
004001 ACTTTGTTTC TGGTACAGTT CCCAGGGCTC TTCCTTGACC CATGGGTAGG AACGAGTTTG CCAGTGGGTC CTTGATAACC 004080
004081 TGAGGCCATT CACCTAGAGC AAGTGAGATT TTCAGAGGAG CAAAGCGCTG GAGTCACCCT GTGAGGCTGC AAGTTAGGGG 004160
004161 AAGCCATGAG ATTTCTGGGG AAGTCTAGGT GTTGTGACTG TGACTGGGGA CTGCTGTGGG TGAGGTTTGA AGAGTGTGGA 004240
004241 GGGACTGTAA ACTCTGCAAC CATCTTCACC CCAAAGGAGG CTGGCTTTTT GGTTTTAAAG CTAACCCCTA TCCTAAAGCA 004320
004321 GAATCTAGAC TTGCAGGGCC TCTCTGAACT CAGGTCCCAG CCTCCCCGCA AAGTCCAGCT GGAAAGGAAA GTTTGGGCGG 004400
004401 GAAGCGAGCG TCCCCGGGTC TGAGGCTGCT GGGTGGAAAG CTGGCCTAGG AGGGCGAGTA GGGAGCAAAA TAGGGCCTGG 004480
004481 TCCTTGCGGG GCCGGGGAGC TAGAGGCCGC AGGAAGCTGG GAGGGCCCTT TCCAGGCAGG CAGGGCAGCC TCCTGGCGCG 004560
004561 GCCCAAGGCG CGAGGCAGCC GCTGGCTAGG GAGGTCCAGT CTCCTGCAGG CCAGGGAGGG CTTCCTCTGG GTGCAGCCGT 004640
004641 CTCCCTCCGC TCCTCAGCTT GGCTACTTGG TGCTCGGACC CCGCATCCTA GTCCTCGTCC TTGTGGGACA GAGGCCAACC 004720
004721 TTGCTGTCGA GGCCCCAATA TGTCACCACA AACACTCCCA GAACAAGAGC ATCAACCCCA AGCTCCAGAA CTTCTGGTCT 004800
004801 TAGCCTACTG GAGCCTGCCA CCAAATTAAA CACCGCGAAG GCTTTGAATC CCTGCAAAGA CGGAGCCTGG AAGAAAGGGA 004880
004881 GGGAGGAAAA GGGAGGAAAA AAAACAAGTT ACATGGAATT AGTTGGAAGC GGGCGCATTC CCCAGCGACC GCAGCCATTA 004960
004961 ACATTATAAT CTCAAACGCC ATTTTTTATG TAACACTATT GTTAGTAAAT CAACTCCTCA GGTCCTCAGA GACGCTGACC 005040
005041 CCTGGCAATT CAGTGAAAGT GTAATTATCT CCCCGAATCT TGGACAGATT TAAGAGATTA CATTTCAACT AAATCTATAT 005120
005121 CAATGCTAAT TCCCTCTCTC CCCCCAGCCT GCAGGTGCTA GGCACGGGAA ATGGCGTCAG GCCCCAGCAG AACGCTTCAC 005200
005201 AAAGAGGAGA GGGCTAGCTG TGTACAGGGC CAAAAGAAAT GAAGCCCCAC ATAAAATTAC ACCTTTTTTT TTTTGCTACA 005280
005281 AAACCTGGTT CTTATATAGC AAAGTTAAAC AAAGCAGCTA TGCTAAATTA GCGTTACATA AAGGCGAGTT TAATGCTCGG 005360
005361 TTACAGTCAA CTGGTGTATC TCTGATGGCT AATTGTCTAT CAAAATTAAA GAGAAAAGAA CAAATGATTC GTTATAAGAA 005440
005441 GGTGTTAAAA GCCTCAACAA AAGGACATTT CACAAATATA ATATCGGCAG CTCCCGGATT GCCTGCGGGG TTGTTCAGGC 005520
005521 CCCGGGCCTG CACAGCTATG AGAAGTGGGG TGCAGGGTGC TATTTGCCCA GCAAAAGCTC ATTTCCTCCC AAATGAGTAT 005600
005601 AATGAAAACC CGAGAGGCGA TATTAGTGTA AAGATCGGGA TTAGTCCAAA TAGGAGCCGC GGACTTGGGC TTCAAAGGCG 005680
005681 ACCCCTACTC TTTTTGCCCA GTCTGGGGGC GGAGGGCGCT CGAAGGGATA CTTCAAGGAC ACCACATCCA ACTTGTCGCA 005760
005761 GCCCCACGTT CAGGCACAGG AGGGAGCGAA CATTGGGCAG AGGGTAATTT CAACAAAGGA CGGCAGGCTC CGGGGATCCC 005840
005841 GGCTTTTCCC TGAGTTCTCT GGGTTGGAAG GAGAGGGTCC GGGCTCTGTC GGAGGAGTGG GTACAGCCCA GCACATGCTT 005920
005921 TTCTGACGCG CAGCGCTGGC CTGGGGAGTG GGTGCAGCTG CTGCAGCCAG CCCCCACCCC GCCCCAGGCT GGGAAGGACG 006000
006001 CAGAGTATAA TACGACGGCC CCCTTCCCCA AGGGGACACT AGATCCAGAG CTCCAGGCAT ATTTGTTGTT CAAAGTTAAT 006080
006081 TATACCTGAA AGCAACCAAA ATGCGCACGC CAGGCCCACG GAGGCCGATT GCCGACCAGC GTAGCCGGCC CGCAGCGCCA 006160
006161 GAGAAGCCGC TCACTCCGGC GGAGTCTCTG CAAGAGAATC TGAGGCTGGG GAATAAAAGC CGAAACTAAA TCAGGCAGCA 006240
006241 AGAGTAACAA ACCATCTGGA AAATGGACCC ACGGAGCCGC AAGAATGTAC TTTTTTTTTT TATCCTTGAC AACTTGTGTC 006320
006321 CTAAAGAAAG TGTATTGAAG ATAATTGAAA TGATTACAAT TCATTGCTGC CTGACTTTGA ATATGAACAG TCACATAATG 006400
006401 ACATCCCCGC CACACAACAA CAGTTTAATT TCCATTATCC GACTTCGGGA TCCTAGCGCC AGCCGCCGGG GCAACGTGGC 006480
006481 GCTAATGCAG AAATCTTGGC TCCTGCCTGC ATTATTCATT TCGGGGACGT GGGGATGGGA TAGGAGTGGA GAGTGGGTTT 006560
006561 CTTCCCCTCC CCCGAACTTA TTCTGAAAAT CCCGGGGACC AATGGACACC GAGGAACCGA AAGCCGAGAG AATAGCTGTC 006640
006641 AAGGGGCCAC TTTGACCGAC GGGGCTGCGG TCGACGGCGC TCCCCGGCTG TCTTTTTGTC CCAGGGGTTC CCAGGCCCGC 006720
006721 AGGGCTAGGA TCCCCCAGCT CCCACCCTAG TCAGTCCCAG TCAGGGAGGA CCTAGGCCAG GGCCTCCTCC CAAGGCTGTC 006800
006801 ATCTGGCGGG GCAAACGCTC TTCTCTCATT CCTTCGTCTC CCTTCCAGCC CTCGCATCCT TTCCTTCTTT CTGCTTCAGA 006880
006881 GCTCTCAGGC TCGCGTGCAG GGCGGGATGG GCCCGGATCG GGGGCCCCTT CGCAGATTTG AAAGTTGCCT CGGCCTTGAT 006960
006961 CTTCTCCCAG CCTCCCTGCT GGGGACTCAC CCCCACATCC CGCTACCCCC CGGGGAAAAG CGAAGAAAGC CAGAGTCTCT 007040
007041 TTGCACGGCG GGGACGCTGG CGCTCACCTC TGGGCGCGGC CTCGGTGGAG CCTCAGGGCC AGGGCGGGGT GTGGCGGGGT 007120
007121 GTGGCCCGGT GGGGTGAGGG AGGGACCCGG GGTGCAAGCC AGGCCAAGGC CTCCTCAGTG CGCAGGCGCC GTTCGGGCCC 007200
007201 GCCGCCCCCT CCCAAGGCGT GGGGTCCCGG GGACAGACCC CGAGCCCCTC TCTGCGCAAC TACCGCCTCT AAAAAAAAGA 007280
007281 CCATCTGGTA ATTGTCTTTC TTTAGATCTT CCCTTAATTA TGCTTTTAAT TAAAGATGGT TCAAGGCACC GGACCACATG 007360
007361 AAGGGCAGTA ATTACAAATT ACATTACAAA CCCGACAGAC GTAGCAGGAT CTGCTGGGAA AAAGGTACCG GAATAAAAAT 007440
007441 TTGACTAAAG TTTGGGATAA ATTAATCGGT GGCTTGAAGA ACAGTAGCAC ATTTCTGATT ATGTAGGCTC CAGCCAGGAT 007520
007521 TTAAGTTTTG TGTCATGATT GTTTTCATAT TTCTTTGACA TCTATTGATT TGGAGGCAGC TGCAAGCCTT TGTCACAGGA 007600
007601 GAGAAGAGCA GTCACAATAT ATTAGCTTGA TGGCATAACT CGAACCGGAG AAGCGAGGGG AGCCTGAGTG ACTGGGGCGC 007680
007681 ACATGACCCC CCTCCTGGGG CCTTTGGGCT CAACCCTTAC TTTTAACTTG TTCTAACAGG AATAATGGAG TAGTACTACT 007760
007761 AATGCATGGT CAGAAGGGGC TTTTCTGTCT AGAACGCAGG CGGCGGGAGT TGCACCGCCA CAGCCCGGGA GACCAAAGAG 007840
007841 TCTCCACTCC CCGCTCCCGG CGCCTCCTCG CCGACCGGAG CCCCGAGCCC AGTGAGCCCA GCCGGTCCCA CGTCGAGAGG 007920
007921 CGCTGGGTTG GGAGAAGTTC TGCTGGTCGT GGGCTCGGCC CCCAGGCGCC AGGCCGAGTG CCCACCTCGG CTTCTTTAGG 008000
008001 GGGCCTACAG CGGGCAGCCG AGCGGCTGGC GGACCCGGAG CTTGGGAGGC GACCGCCAGG CTGGTGCCCG GCCTGACCCG 008080
008081 GCGTTcgcgg ccgcccgctc gcccgccgcg ggccgggAGC GTACAGGAGT GTGACGCAGA TTGTGAAAAC AGAAGGGAGG 008160
008161 GAGTTGGGTC ATTTCCTTCG CTAATCATCG CCCCCTCCTG CTCCTCCTCC CCACCCCCAT CCCATCCTCG CCGCCACCCA 008240
008241 GCCTCGAACT CTCTTCCTTG CCAGAGTCTG CCTCACTTTG AGCCAGTGGC TGCACTTTAT GGAGAAAATA TATGTGCCCA 008320
008321 TCACTCACCC ATCTATTTGC AGCGTCCATG GAGCGCCTCG GGGAACACGC ATGGACAATT AAACACACCC ACTTACGGCG 008400
008401 GGATGATGAG GCTTTCTGTT AACCACATGT GTTCAGAAAT GGATACAGCC CTAATTTTGA CACGGAATGC AGCTAATGCA 008480
008481 CCTTGCTATA GATGTACGTC CGTTGGAAAA GTGTGTGATG GGCACCTGAT CTACACCAAG AGAACAGGGC TGTCTGCAGA 008560
008561 AGACCCAGCG GCCTGACACC TTTTCTTGTT GCCGGGGAAG GAAAGTTTTT CTTTTGATTT GTCCTCTCAC GATTTTTCCC 008640
008641 TTTTCCTTTG CATTACAGTT TCAGAGAGGA ATGTAAATAT TTTGACTAGA CCTCTGCAGG GGCCTTTTAA ACACCAGGCA 008720
008721 CAATCATCTG TGGAATACTG TAGTTCATAC TTTCAAAACT TGGGTGTTAA AGAGTCTGTC TTGCTGAGGA AACCCATAGA 008800
008801 ACTAGTGGCG ACCTTTCAAC TCCCTATTTG TGTGATGAAA TGAAGTATGC CCTAGTGATT GTCGAATTTT AAGGACTTGT 008880
008881 TCTGTCACTG CTACTTTCCG ATCGTTTGCA GGGAAGAAAA ATCAATCAAA CAGACCTTTG ATGGGGTTGT GGCAAGGTCA 008960
008961 CATTTCACTG TGCTCCAGGC TTACCTCTTC TTAACGCCCC TCCCTGCTGT GGAGCGTGTG CAGGTAGTAT GCAAAACTCT 009040
009041 AGAAATAATA TTTGAAAAAA TTAACACCTT GTTTATCTCT TCTGTGTATT TGATATAGGG GTTTCTTTCT TTTCCTGTTT 009120
009121 TGGTGTTTAA TACAAGGCTG ATATATTGGA ACAGAATGCA GACTTCAAAG AAACTAAAAT TAGGAGGCAA ATAGCGTCAA 009200
009201 GGTTTCCTCG GTTTCTGTAT GTAGTACAAA TAGTATAGCG TCTTTTCATC CAAAAAGAAG CAAAAATTGC CAGGAGGCAT 009280
009281 AAAGCATCTC TGAATATCCG TTTTTTTTAA AGAAACAAAC ATTTCCCAAA TATTGATGTA CGCATGGTTT TATAGTCTGA 009360
009361 AAATATTTCT AGGCACAAAT ATGGCATACA AACATTCGTT TCAACTCTGT CGTTGTTGTT AAAATGACAG TAAATTATAG 009440
009441 TTTATTTTAA GATACCTCCC TGTTAATGTC AGTTGAGGTT ATTTTAGGGC CTGGATGCTC TAGGAAGACC ACCTAAAATG 009520
009521 TGTTTATTTC TCTGCCCAAT TCACCTATAG TGTAAGGAGC attttatttt attttatttt attttatttt attttattat 009600
009601 actttaagtt ttagggtaca tgtgcacaat gtgcaggttt gttacatgtg tatacttgtg ccatgttggt gtgatgcacc 009680
009681 cattaactcg tcatttagca ttaggtatat ctcctaatgc tatccctccc ctccccccat cccacaacag tccccagagt 009760
009761 gtcatgtAAG GAGCATTTTA AATAAAATAT TTTGGGCATC CTTAAGTCCT TTTTTAAAAA TCCAACATTC TACAATTGTG 009840
009841 ACAAATAGGC TGAAAAATTT TGTTTTGTTT ATACCAAATT CATTTTAATA AAGCATTTGC TGAGATTTTA ATACAACAAA 009920
009921 TGCCAACAAA ATGCATCAGA GTAGAAAAAA GAAAATATTT TCAGAATTGC CTATAATATT GCTTGTGATC CTAAATTTTT 010000
010001 TGATGCAAGG AACTTGAATT TTTCAGCTAA TATTATTCTG TTTTCTTATT CTGTGTTTCT ATTAGAACAC TCACCTATGC 010080
010081 TCTGCTTCCC TTGCTGTCTT CCCATAGCTT ATGTGTGCAC TATGAATTTC AATAAATATA AATTACTGCT TAAAAGAGTA 010160
010161 AAGAATGGCT ACTTTATGAC TCACTGTTCT CTCCTTACAA TCTGCTCAAA AATCTTTTTT ACAAATCCCA TTGTAGCTAC 010240
010241 TTCCCCTCAA TTCCACGATG AAAGTGAATG GCAAATGCCA TTCAATTTAG AGGAACTCAA GCACAGAGAA TATAAAGATG 010320
010321 TTGTTCAAAG CCTCCCTCAA ATCTATCTGT AGGCTTACAA ACAAAATGAG ACTGGAGGCA ACATCAGTAC ACATCTCCGA 010400
010401 CTCCATATGA GGTTACTTGA AGCTTTGGGG TTCACTCTGG AAACAGAAGA CATGCATCAA GGTATGTGTT CCTTAGAGAC 010480
010481 TGACAAGCAA CAGTGGACCT CAGGAGAAAT AAAACAACTC ATGCTCTCAA CTGCCTCTGA TTTGCAGACA AGGAAGAGTT 010560
010561 TTCTCTAAtt tttttttttt tttttttttt ttGCCTGCAT TACTTTTTCT GTGCTTGGTG gctaaaccag agagcagtct 010640
010641 gcaacatttt gcttttgggg atttcctgtg gctttgccac attccctgga gaaactcata aagtcctgga gtctatggag 010720
010721 ggattacaga gagccacaaa catcattctt cctctaatcc atctggggca gatacagtat tgataacaac ctttctgtta 010800
010801 cttgacagtt tcagaccatT CAGATGAGAA CAAATAATAG GAATTTGGTA GTGGAGGTGG GGAAAATAGA GGCAATTGGT 010880
010881 ATAGTCTTCT GAGTTGAAAG GACTGGTTTC CATTCCAAAA TCGTGGAAAC AAGTACAAAA TTAAACACTT TCCATTCAAT 010960
010961 TCTTTGGAAG TGATTTCTTC TGTCTTTGGT TATTGTAGTG CATTTGTGTT GGGGAATTGA TGCATTTATT TACTTTGTCC 011040
011041 CTAAGACAAG ACAGTGCTCA GTTGCTTGCA TTTTGTAGCT TCAGTTTGTT TGGCTCTCCC AGCTTGAACC TACTATGTTA 011120
011121 GGTAATAAGG AAGCCCATTT GCATTAGATA ATAAGAATCA GGGACAAGGC AGACACAATG CTGATTAAAC AAGGGCTCAT 011200
011201 ATCCCATTTT GAGAGCTCCC TGATAACCAG CGCCACAATC ACATTGGTAG GTCAAGCAAA AATCTGAAGA TAAAATCAAT 011280
011281 GTCAGTTTTC TGTCTTGGTG ACAGACAGCG ACCCACCAGA ATTATATCCA GTAAATCCTG TTATCAAGTT CCTCACTGTC 011360
011361 GTTGATGAAT TCACTTATGC TATGGGTCAG AGATTATGCT GTGGCCACCA CCTATGTGAT GATGTCTACG GCATCCCTCA 011440
011441 CTTTGACACA GACTtacaca gaacaatacg ctaacaatta tagctgtcca acttcctggt ctgctttgta aggtaagggc 011520
011521 agtgaagaca ctgggaatgt tcaagtggaa tctggGGTGT GGGGAAGACC AAACCTGCAT GAAGGAGTGG TTAGGGAAAT 011600
011601 TAACTTACTT CCCAAACTGT ATCAGGGCCA GAATCATCCC AGAAACATTT ATTTTATCTA TTGGttattt attaaataat 011680
011681 ttaaatatGA TTACTTGTCA AAATGAAAGT ACATTCATGT GGTTCAAAAT TCTGAAGTTC AGAAAATATT TTGTGAAAAT 011760
011761 TCTTCATATC CAGTCATACA GCCACCCCCT TCTTACCTAT TGAAAGCAAC CAACACTATC AGTATCTTAT GTATAGGGGA 011840
011841 GCTTTAAAAA TATGGAATTc caaggcctac ttaatgagac tctttggaga cagaggcttt gctattggtg tttaaaaaaa 011920
011921 atctttccag ataagtttgt tgATATGTGG GCACTTAAGT GATTTTTAGA CTTCTTTCAA ACACTGAGAT TTTATGGAAA 012000
012001 TATATAATGT aatactactc gtcccctacg ttcctacaat gtgtgtaaag tattttcaaa actagtatat atttttttct 012080
012081 ttttgcaacc ctgtaaaata ggtattattt tctgccccct tcccattttt cagagaatgg aaacttctga aaaactctca 012160
012161 gaagtttgga caacttgacg gaggtaactc agctagtaaa cagcagggtc aggTAGCATC Attcaaggcc atgctaggac 012240
012241 ctaagtgctt ttactttgag ctttacccca catcacatca aatgataaca tgacccgtac ttcaacataa ttatttgcta 012320
012321 taaactgttt taaaataatt ttgataaatt tgaagttcat taggaatgaa ttattcattt catttttatg attAAACTTT 012400
012401 ACTACattta tacatgacat gtaagttgag ttgcagctgg tgtgttgaca tgatgtcaac gcttttagtc atgtaaacat 012480
012481 ttatcaatgc tgactctgTG TGTGTATGTG TGtgagacag ggtgttactg tgtcgcccag gctgtagtgc agtggctgta 012560
012561 atcttggctt actgcaacct ccacttcaaa cgaccctcct acctcagcct cctgagtagc taggactaca ggcatgcacc 012640
012641 accatgcccg gctaattttt aaattttttt ttgtagagat agggtttcgc catattgccc aggctgatct tgaatttctg 012720
012721 ggctcaagcg atctgcccac cttggcctcc taaagtgctg ggattacagg agtgaacgct gcacctggcc GATGCTGACT 012800
012801 TTAAAGTTGC TGCCATTTTt ttttttttca tattttggag ctactaattt tggggataag ggcaagaatt caaatatctt 012880
012881 ttcaagcttt tgaggagctt gtaggtttta ggttctatac ttgaggtgct tgttttagtt aggttaaggc taaatttctc 012960
012961 taacaaatag ccccagaaaa aattcagtgg attaaagaga ataagagttt attttccttt catctaacag tctgaggtgt 013040
013041 atgtttcagg gtagcaggca gcttgcttta tgtagttttc cagccatcta ggattctcta tcccttaggc tattgccttt 013120
013121 atctgcatga accatagatt cctccaggtt ctggttcata agtggagaaa gtgcaggagg tgcgtccatg gtttttaggt 013200
013201 ccatggtcta ccttgaaact ggcacacatt ccttctgctc acattccttt gttcagaact tagtcacatg tccacagcaa 013280
013281 actacaagTA GAATTGGTCA ACCCATATTG ACCCAAATGC GGTGGTGACC CACATGTAGT GAAACAACCA GCAGCATTCA 013360
013361 CAACAATGCA TAATGcagct aggagactgt tacaataatc caggtagaag ctgatgatgg tagcagtggt atttgtggga 013440
013441 gataactgaa ttctggatat attttaaaga atatcctaat agattggata aggctgtgag tcaaagaaga gtcaaggatg 013520
013521 atgtccaggt tttggcctga gaaactagaa gaacagattt ctcatttata gaggtgagga agactgagga ggaaatttct 013600
013601 gtagaaaggc aaagaatttg gtgttggata tattgggtgt gagatgccta ttagaaatcc aagtaaaaat gtcatgtaag 013680
013681 agttgagcat atgagtctgg agttttaaaa ctaaacactg aataaagtca acaaggaaat caatataggc agagaagaag 013760
013761 cctaaggatc aagctttggg acatgttgat gtttagaggt ctggaagatg aagagaaatt gaggggagtc cctagaaagg 013840
013841 caggaggata accaggaaag gctggcacac aggagtccaa ttggagaaag cattttagga agcggaacat gatcaacctt 013920
013921 taaacaacta tagtgttaaa tactgtaaat aggtcatgtt ggatgagaac tgagaattga ctgttggatt tatcaatatg 014000
014001 tcatggattt ttggggaaag tgactagtag gaatagaata ttggaataaa aacataatga aaggagagaa atttgaggca 014080
014081 gcacaagtac ctataactat ttcagtgatt tttgttgcaa aggggtaagc agaaaaatgg ggcagtagtt agagatcaag 014160
014161 gttttttaaa ggttgcatga aaaaatcttc atgtttggat tctattggga aatcattcac tagagaaggt aaaattaatg 014240
014241 atgcaaggaa ggagtggaga attgtcttat cagtgtccat gagaaggcaa gaagaaatag gacctagttc acaaatggag 014320
014321 gtgttggtct acttgcaagc atggatgatc cattcacaat aatgggacaa agcagagtga acagctcaga tacagtgtag 014400
014401 caggatgtgg tgaaggtgct tgttcttttc tgattttctc aataaaattg taagtcaggt cattatttca gaagatggag 014480
014481 aaggagacac tgtgggtttg aggtgaagag ggaaattggg aaactcagct agacaatggg tgtgtgaaat aacaggagac 014560
014561 ttgtacaagg tttttgggca tctctggggc ctagtcggcc tcactggtgt atacttttct ctaggcacag ctcaggtaca 014640
014641 gagtaggctg agagttggat ttggttagga ttgggctgtt gcaaggagag acagtatgat gaagggagag aaagaggcaa 014720
014721 gggagttact tgtgtgtgca aacgggttac tccgtggaat ctaaactggg tagaaaagga cgtgaaaacc tgaggggata 014800
014801 aagaccagtg gagaagtgat aggattaaag gattttagat ttaagtgggt caatgagttg ttgaagtgat ggagtgagca 014880
014881 ggaaagatag taaatgatag ttggagagtg aaatggagat gaccgagggg tgaaattaat gtcaaagtat agcataagac 014960
014961 catgggagtg ggtggtagct ggagcaacag aggtcaagga actgaaaagc aagggcactg gaaggatcat agatattgaa 015040
015041 attctgaaga attagggcag gggccatgct ggaaggaggg atggtgagat aagagctaaa gccttgaaga atgagtggga 015120
015121 aagacctggg agcctataga cttcagctac cagtgtggga tagctggata gccaccaatg tgggatagtc tgatggcatg 015200
015201 agagtcaaag ctggaagatt ttagggagga ggaagaaaca ggtatgaaag tgccagagaa ggcaggccct gtggtttgag 015280
015281 tgacatggag agaagctacc acctgagggg gctgcagagg aacagcccag tgtcaggaag agaaagtgaa ggtccctcaa 015360
015361 agaagaggat agaggtgatt gtgctaggac agactcgagg gcacactgga gggatatagg gaCAGATTAG AGCACTTATG 015440
015441 GAATTCTATG GAATCTTGAA CCTTCCAGGT CCTGGTTCAT CTATGAATGT TGATATCTTA TGACTTCAAA TTTACTCCCT 015520
015521 CCCTCTGGGC TTCTCTCTCT TGCTTTTATA GGACAGTCCT TTCTGGTCAT TCAAATCATT TATCTGTCCT CTCTGCCATC 015600
015601 CCTCTCATGT ACCTTTCAGG TCTTCCACTT ATTCTATtcc ctccctccct ccctccctcc ctacttcctt ccctacctcc 015680
015681 ttccctccct tcttccctcc ctccttctct ctctctctct ctcacacaca cacacataca cacacacact cacaTCTATC 015760
015761 TCCGTGAACA GAACTTTGGC ATAAACTTCT GAGCGTACGG AAATAGATTT GGCTCCTTAC ATTAATAAAT AATAGTATGC 015840
015841 ATAATGAGGA AAACATTTAA ATCTAAACAA TACAGAACTT AGTAAGGTAG GAAGTCAGTT TCCCCTACTT TCATTTCAGT 015920
015921 CCTAAACACA TCCTTTTTTA AGCAGAATCC ATATAATGTT TATTATATAA CCTTCCAAAT TATTTTTAAC GCTAGACATT 016000
016001 TACGTACACA CACTTGTATA TACTCATTAA TGGAATAAAG GTTCTGGTTT TTTTTCCGGC GGAGGGTcat ttaacataga 016080
016081 ttatctttgc aagtcactgt catattattt tgtttttagc ggacacacat tatgccattg tgtgaataaa acattctgta 016160
016161 gtgatggaca tttaggttgt ttggaacttt ttctattata aataatactg tagtatactt ccctgtacat atccttgtgc 016240
016241 taaaaatttg gaagctagac tcctacaact aaagttgctg aatgttacac tgaatgtaca ttttaaaatt tggctgacac 016320
016321 tgccaaattg tcaccctccc caaatcatgt accaatttat actcccacta gcagtttatg agtgtgcttc tttccccata 016400
016401 ccctacccag taatttgCCT CCTTCTGGAG GTTTGTAAAG AAGCAATCTG TCAGACAGTG GAAGAGGCAA ATGAGAATCT 016480
016481 GTGTACACTG AATacacctg acaccttgtt gaatcccagg gttggttctg ctgatctggc tgactaagca gggggtcccc 016560
016561 cttctccccc tctctctggg ctccatgggg atcccagctg aggaacggtt gatgaggGGC ACTGGGGTGC TCGCCTTCAC 016640
016641 TTTGATTTAA AGTCTGCTTC TCAGTCCACT GCTACTCGGG GACAACATGC TCTGATGGCT GATAATATGC TCTATTTGTA 016720
016721 TTCTAGCTGG ATATAGGTAT TAGAGCCAAG TGTTTATTCA TTTCCATCAG GGGAAGTCTT CAGGCACCGG GTGCTCACCT 016800
016801 TGATCTTTAA TTTTAATCAC AAAATCAAAG CCCTGCTGTC ATTTCAAAGG CTCACTCAGA CACTAAACTT TAGAAGGTCT 016880
016881 ATTAGTCCTC ATCCCAAATG GGTAGGAGAG GTGGATGCTT CCATTACAGG GCTCCATCCC CATTGCCTTT TCCCCTGATT 016960
016961 TAAACTAAGG TGCAAAGGAA GAGAAAGACT GCTCACTGAA GCTCACAACC TTTTAAAGTA CCAATAATTT GCATGAACAA 017040
017041 TGATGCCCAC TTTTGTTTTT AAGACCACTT AATAGACTTC ATTTCTTAAA CCAAAATCAC TGGTTAATCT TTCCAGACTG 017120
017121 AGTCCTCAGA AGGGAACTGC TACAAATTTA TTCAGAGGAT TTCAAGCAGT AAAAATAATG TGCAGTTCTT TTTAATGGGT 017200
017201 AATAAAATTC CCCAAGAAAA ATGAATCTTT CTAGGCATAG AGTAGATGCT TTTCAAAGAA GACTCACTAT CTCCTTTTTA 017280
017281 AAAGAGAAGA GCCTttttgt ttttgtaaaa tcaacacatt taaagtttaa aattcaaatg atgcagaaaa atataatgaa 017360
017361 gatagtttaa aaacacgtga aattctacaa cccagaaaaa atcacattac catttttgcc aaaacacatt tctataaaca 017440
017441 ctctatagat ttatacatat aTGTGGACca tactcttttg taaattgctt tttatttcac tcaagaatgt gcaatatcca 017520
017521 tctcctcata tatgttactt taatattgat aaacatttta ttgtatagat gcctcatcat ttacttagct agtgttctaa 017600
017601 tgatggacag ttaggatcct cctaatatat ttctgcaatt gcaaatgata ttgctatgaa gaaccttAGA GCTAACTTCG 017680
017681 CACATGTCTT TATATACTTC CATGTAATAC TTTCCAGAAG TAAAATTAAt ggcaggtaag aattctacca ctgaaccacc 017760
017761 catgcTAGAA AGTAAAATGA ATGGATTTAG AACATTTGTA CTTTTTAAAG TActttagaa aggtattgaa ttgtaatttc 017840
017841 acagcaaatt atgagactgc tatttcccca tacggtagca gatatgaaat aatacaattg atattgatt
[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "NONHSAT018635" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=NONHSAT018635&oldid=1272104 (Last update: Jun 30, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu1.948122230.8762016-06-25 14:33:41[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.268126812016-06-30 12:53:19[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox