From LncRNAWiki
Jump to: navigation, search

PAUPAR, a vertebrate-conserved and central nervous system-expressed lncRNA transcribed from a locus upstream of the gene encoding the PAX6 transcription factor, acts in a transcript-dependent manner both locally, to regulate Pax6, as well as distally by binding and regulating genes on multiple chromosomes, in part through physical association with PAX6 protein.


Annotated Information


PAUPAR:PAX6 upstream antisense RNA(HGNC nomenclature)


Paupar acts in a transcript-dependent manner both locally, to regulate Pax6, as well as distally by binding and regulating genes on multiple chromosomes, in part through physical association with PAX6 protein[1].

Paupar binding sites are enriched near promoters and can function as transcriptional regulatory elements whose activity is modulated by Paupar transcript levels[1].

Paupar can function in trans at transcriptional regulatory elements distinct from its site of synthesis to control large-scale transcriptional programmes[1].


Conservation and expression of Paupar[1].

qPCR Primers are as follows,

qPCR Primers Forward Reverse
Paupar accatcacccctgcaatagttc agcagcctttgagccatctc[1]
Pax6 caccgccctcaccaacac tgcataggcaggttgtttgc[1]
GAPDH tgtgtccgtcgtggatctga cctgcttcaccaccttcttga[1]
Idh1 agaaaatgtggaagagccctaacg tgccagctcgatctaccacaaaat[1]
TBP tcagttctggaaaaatggtgtg tgctgctagtctggattgttct[1]
Pax6OS1 gctgagatctgtggctgaaagg agtccccaggcttgtctaagg[1]
Malat1 cgtttgaaggcatgagttg tgcctcccaagtgctaggat[1]
Tubb3 gcgcatcagcgtatactacaa ttccaagtccaccagaatgg[1]


Paupar transcripts are known from dog, as well as from more distantly related vertebrates, frog and zebrafish. Paupar is unusual in exhibiting higher degrees of sequence and transcriptional conservation than most lncRNA loci[1]

Labs working on this lncRNA

  • MRC Functional Genomics Unit, University of Oxford, Oxford UK[1].


  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Vance KW, Sansom SN, Lee S, Chalei V, Kong L, Cooper SE, et al. The long non-coding RNA Paupar regulates the expression of both local and distal genes[J]. The EMBO journal. 2014,33(4):296-311.

Basic Information

Transcript ID




Same with





17909 nt

Genomic location


Exon number




Genome context

000241 gggagtgggg gtaggggtag aggtgggggt ggcggtgaag gtggggAGGA GAATGGGAGC TTTGGCTGAG AAGTTTCCGC 000320
002481 caaaaaacaa acaaacaaac aaaacaaaac aaaaaacTCT ACAACAATCA ATTTGAGAAA ACTCTGCTTT TTCTTTCCTT 002560
008081 GCGTTcgcgg ccgcccgctc gcccgccgcg ggccgggAGC GTACAGGAGT GTGACGCAGA TTGTGAAAAC AGAAGGGAGG 008160
009521 TGTTTATTTC TCTGCCCAAT TCACCTATAG TGTAAGGAGC attttatttt attttatttt attttatttt attttattat 009600
009601 actttaagtt ttagggtaca tgtgcacaat gtgcaggttt gttacatgtg tatacttgtg ccatgttggt gtgatgcacc 009680
009681 cattaactcg tcatttagca ttaggtatat ctcctaatgc tatccctccc ctccccccat cccacaacag tccccagagt 009760
010561 TTCTCTAAtt tttttttttt tttttttttt ttGCCTGCAT TACTTTTTCT GTGCTTGGTG gctaaaccag agagcagtct 010640
010641 gcaacatttt gcttttgggg atttcctgtg gctttgccac attccctgga gaaactcata aagtcctgga gtctatggag 010720
010721 ggattacaga gagccacaaa catcattctt cctctaatcc atctggggca gatacagtat tgataacaac ctttctgtta 010800
011441 CTTTGACACA GACTtacaca gaacaatacg ctaacaatta tagctgtcca acttcctggt ctgctttgta aggtaagggc 011520
011521 agtgaagaca ctgggaatgt tcaagtggaa tctggGGTGT GGGGAAGACC AAACCTGCAT GAAGGAGTGG TTAGGGAAAT 011600
011841 GCTTTAAAAA TATGGAATTc caaggcctac ttaatgagac tctttggaga cagaggcttt gctattggtg tttaaaaaaa 011920
012001 TATATAATGT aatactactc gtcccctacg ttcctacaat gtgtgtaaag tattttcaaa actagtatat atttttttct 012080
012081 ttttgcaacc ctgtaaaata ggtattattt tctgccccct tcccattttt cagagaatgg aaacttctga aaaactctca 012160
012161 gaagtttgga caacttgacg gaggtaactc agctagtaaa cagcagggtc aggTAGCATC Attcaaggcc atgctaggac 012240
012241 ctaagtgctt ttactttgag ctttacccca catcacatca aatgataaca tgacccgtac ttcaacataa ttatttgcta 012320
012321 taaactgttt taaaataatt ttgataaatt tgaagttcat taggaatgaa ttattcattt catttttatg attAAACTTT 012400
012401 ACTACattta tacatgacat gtaagttgag ttgcagctgg tgtgttgaca tgatgtcaac gcttttagtc atgtaaacat 012480
012481 ttatcaatgc tgactctgTG TGTGTATGTG TGtgagacag ggtgttactg tgtcgcccag gctgtagtgc agtggctgta 012560
012561 atcttggctt actgcaacct ccacttcaaa cgaccctcct acctcagcct cctgagtagc taggactaca ggcatgcacc 012640
012641 accatgcccg gctaattttt aaattttttt ttgtagagat agggtttcgc catattgccc aggctgatct tgaatttctg 012720
012721 ggctcaagcg atctgcccac cttggcctcc taaagtgctg ggattacagg agtgaacgct gcacctggcc GATGCTGACT 012800
012801 TTAAAGTTGC TGCCATTTTt ttttttttca tattttggag ctactaattt tggggataag ggcaagaatt caaatatctt 012880
012881 ttcaagcttt tgaggagctt gtaggtttta ggttctatac ttgaggtgct tgttttagtt aggttaaggc taaatttctc 012960
012961 taacaaatag ccccagaaaa aattcagtgg attaaagaga ataagagttt attttccttt catctaacag tctgaggtgt 013040
013041 atgtttcagg gtagcaggca gcttgcttta tgtagttttc cagccatcta ggattctcta tcccttaggc tattgccttt 013120
013121 atctgcatga accatagatt cctccaggtt ctggttcata agtggagaaa gtgcaggagg tgcgtccatg gtttttaggt 013200
013201 ccatggtcta ccttgaaact ggcacacatt ccttctgctc acattccttt gttcagaact tagtcacatg tccacagcaa 013280
013361 CAACAATGCA TAATGcagct aggagactgt tacaataatc caggtagaag ctgatgatgg tagcagtggt atttgtggga 013440
013441 gataactgaa ttctggatat attttaaaga atatcctaat agattggata aggctgtgag tcaaagaaga gtcaaggatg 013520
013521 atgtccaggt tttggcctga gaaactagaa gaacagattt ctcatttata gaggtgagga agactgagga ggaaatttct 013600
013601 gtagaaaggc aaagaatttg gtgttggata tattgggtgt gagatgccta ttagaaatcc aagtaaaaat gtcatgtaag 013680
013681 agttgagcat atgagtctgg agttttaaaa ctaaacactg aataaagtca acaaggaaat caatataggc agagaagaag 013760
013761 cctaaggatc aagctttggg acatgttgat gtttagaggt ctggaagatg aagagaaatt gaggggagtc cctagaaagg 013840
013841 caggaggata accaggaaag gctggcacac aggagtccaa ttggagaaag cattttagga agcggaacat gatcaacctt 013920
013921 taaacaacta tagtgttaaa tactgtaaat aggtcatgtt ggatgagaac tgagaattga ctgttggatt tatcaatatg 014000
014001 tcatggattt ttggggaaag tgactagtag gaatagaata ttggaataaa aacataatga aaggagagaa atttgaggca 014080
014081 gcacaagtac ctataactat ttcagtgatt tttgttgcaa aggggtaagc agaaaaatgg ggcagtagtt agagatcaag 014160
014161 gttttttaaa ggttgcatga aaaaatcttc atgtttggat tctattggga aatcattcac tagagaaggt aaaattaatg 014240
014241 atgcaaggaa ggagtggaga attgtcttat cagtgtccat gagaaggcaa gaagaaatag gacctagttc acaaatggag 014320
014321 gtgttggtct acttgcaagc atggatgatc cattcacaat aatgggacaa agcagagtga acagctcaga tacagtgtag 014400
014401 caggatgtgg tgaaggtgct tgttcttttc tgattttctc aataaaattg taagtcaggt cattatttca gaagatggag 014480
014481 aaggagacac tgtgggtttg aggtgaagag ggaaattggg aaactcagct agacaatggg tgtgtgaaat aacaggagac 014560
014561 ttgtacaagg tttttgggca tctctggggc ctagtcggcc tcactggtgt atacttttct ctaggcacag ctcaggtaca 014640
014641 gagtaggctg agagttggat ttggttagga ttgggctgtt gcaaggagag acagtatgat gaagggagag aaagaggcaa 014720
014721 gggagttact tgtgtgtgca aacgggttac tccgtggaat ctaaactggg tagaaaagga cgtgaaaacc tgaggggata 014800
014801 aagaccagtg gagaagtgat aggattaaag gattttagat ttaagtgggt caatgagttg ttgaagtgat ggagtgagca 014880
014881 ggaaagatag taaatgatag ttggagagtg aaatggagat gaccgagggg tgaaattaat gtcaaagtat agcataagac 014960
014961 catgggagtg ggtggtagct ggagcaacag aggtcaagga actgaaaagc aagggcactg gaaggatcat agatattgaa 015040
015041 attctgaaga attagggcag gggccatgct ggaaggaggg atggtgagat aagagctaaa gccttgaaga atgagtggga 015120
015121 aagacctggg agcctataga cttcagctac cagtgtggga tagctggata gccaccaatg tgggatagtc tgatggcatg 015200
015201 agagtcaaag ctggaagatt ttagggagga ggaagaaaca ggtatgaaag tgccagagaa ggcaggccct gtggtttgag 015280
015281 tgacatggag agaagctacc acctgagggg gctgcagagg aacagcccag tgtcaggaag agaaagtgaa ggtccctcaa 015360
015361 agaagaggat agaggtgatt gtgctaggac agactcgagg gcacactgga gggatatagg gaCAGATTAG AGCACTTATG 015440
015601 CCTCTCATGT ACCTTTCAGG TCTTCCACTT ATTCTATtcc ctccctccct ccctccctcc ctacttcctt ccctacctcc 015680
015681 ttccctccct tcttccctcc ctccttctct ctctctctct ctcacacaca cacacataca cacacacact cacaTCTATC 015760
016081 ttatctttgc aagtcactgt catattattt tgtttttagc ggacacacat tatgccattg tgtgaataaa acattctgta 016160
016161 gtgatggaca tttaggttgt ttggaacttt ttctattata aataatactg tagtatactt ccctgtacat atccttgtgc 016240
016241 taaaaatttg gaagctagac tcctacaact aaagttgctg aatgttacac tgaatgtaca ttttaaaatt tggctgacac 016320
016321 tgccaaattg tcaccctccc caaatcatgt accaatttat actcccacta gcagtttatg agtgtgcttc tttccccata 016400
016481 GTGTACACTG AATacacctg acaccttgtt gaatcccagg gttggttctg ctgatctggc tgactaagca gggggtcccc 016560
016561 cttctccccc tctctctggg ctccatgggg atcccagctg aggaacggtt gatgaggGGC ACTGGGGTGC TCGCCTTCAC 016640
017281 AAAGAGAAGA GCCTttttgt ttttgtaaaa tcaacacatt taaagtttaa aattcaaatg atgcagaaaa atataatgaa 017360
017361 gatagtttaa aaacacgtga aattctacaa cccagaaaaa atcacattac catttttgcc aaaacacatt tctataaaca 017440
017441 ctctatagat ttatacatat aTGTGGACca tactcttttg taaattgctt tttatttcac tcaagaatgt gcaatatcca 017520
017521 tctcctcata tatgttactt taatattgat aaacatttta ttgtatagat gcctcatcat ttacttagct agtgttctaa 017600
017601 tgatggacag ttaggatcct cctaatatat ttctgcaatt gcaaatgata ttgctatgaa gaaccttAGA GCTAACTTCG 017680
017681 CACATGTCTT TATATACTTC CATGTAATAC TTTCCAGAAG TAAAATTAAt ggcaggtaag aattctacca ctgaaccacc 017760
017761 catgcTAGAA AGTAAAATGA ATGGATTTAG AACATTTGTA CTTTTTAAAG TActttagaa aggtattgaa ttgtaatttc 017840
017841 acagcaaatt atgagactgc tatttcccca tacggtagca gatatgaaat aatacaattg atattgatt
[back to top]
Personal tools
