Lnc-CHRAC1-2:1

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "Lnc-CHRAC1-2:1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=Lnc-CHRAC1-2:1&oldid=1272226 (Last update: Jun 30, 2016). [See details]

A novel lncRNA that is transcriptionally regulated by E2Fs, and restricts apoptosis induced by E2F1, as well as by DNA damage.

Contents

Annotated Information

Name

ERIC restricts E2F1-mediated apoptosis[1]

ERICD:E2F1-regulated inhibitor of cell death(HGNC nomenclature)

LINC01130, "long intergenic non-protein coding RNA 1130, ERIC, TCONS_00014875[1]

Function

Endogenous E2F1 regulates expression of ERIC.[1]

ERIC levels were increased following DNA damage by the chemotherapeutic drug Etoposide, and inhibition of ERIC expression enhanced Etoposide -induced apoptosis which prevents E2F1-induced apoptosis from occurring at the “wrong” time [1].

Regulation

ERIC is transcriptionally regulated by E2Fs, and restricts apoptosis induced by E2F1, as well as by DNA damage.[1].

Expression

Expression of ERIC was cell cycle regulated and peaked in G1 in an E2F1-dependent manner. Inhibition of ERIC expression increased E2F1-mediated apoptosis, suggesting that E2F1 and ERIC constitute a negative feedback loop that modulates E2F1 activity[1].

siRNA Sequences
ERIC si#1: AAGCCAGCCTGTGGCTACCTCCTTT[1]
si#2: CCCGTGGCATCGGCTGTCTGCATAT[1]
SiE2F1 si#1- CUGAGGAGUUCAUCAGCCU[1]
si#2- CAGAGCAGAUGGUUAUGGU[1]
SiE2F3 si#1- GCCUUAAAGACCAAACUGU[1]
si#2- CAUAUCAAGAUAUUCGAAA[1]

Disease

Retinoblastoma[1]

Labs working on this lncRNA

The Mina and Everard Goodman Faculty of Life Science, Bar Ilan University, Ramat Gan 52900, Israel

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Feldstein O, Nizri T, Doniger T, Jacob J, Rechavi G, Ginsberg D. The long non-coding RNA ERIC is regulated by E2F and modulates the cellular response to DNA damage[J]. Molecular cancer. 2013,12(1):131

Basic Information

Transcript ID

lnc-CHRAC1-2:1

Source

LNCipedia2.1

Same with

NONHSAT129383,ERICD,LINC01130, "long intergenic non-protein coding RNA 1130, ERIC, TCONS_00014875

Classification

intergenic

Length

1745 nt

Genomic location

chr8+:141646243..141648531

Exon number

2

Exons

141646243..141647585,141648130..141648531

Genome context

Sequence
000001 CGGAGGTCGG GAAGCTCCCT CCCAGCCCGG AGCTTGAACT TGAACGCGGC CGGCCGCTCG CGCAGGACCA CACCGCCACC 000080
000081 TCCCGGCGCG GCCCCAGAAC CCAGATAATC CGTTTAAAGC ACTGAGAAAA TCTAAGAAGT TTTTAGTAAA CTGTAGCTGG 000160
000161 TATCAGGGAT CAGATCAGCG GACACGCCCA TTCCAGCAGT CAGGGGCCTG CTCGGACCGT CGTGCACCTC CGAGCGTTTC 000240
000241 TGTCCGGTCC CTCTGGGTCC GTCTGGTTTT CGGAGGCTTT CCTGGAAAAG CCAGCCTGTG GCTACCTCCT TTCTCCCCTA 000320
000321 AGTGATGGAG GATTAGAAGG CAGAGGTTGA CCCACAATCT AAAGTGCCTG GTCGCCTTTT CCCAGATTTC CCGGAGCATT 000400
000401 CCTTCACCCC GTGGCATCGG CTGTCTGCAT ATGGGTGCAA GGCCCTGTTC CGGGCGGAGA ATAAACAGGA GTTCTGACTG 000480
000481 ACAGGAGCTC CGCAGCCAGC AGGGTGGTCA CTAGTTCTCT GCAGTCTCGG AGGACAGCCC TGAAGAAGGG CAGGAGAACC 000560
000561 AGCACTTCCT CCGAAAACTC AAAAGGACAT CAGTCTTCAC CAAGTTGCCG ATACAAAACG TGCTCCTGAA ATGTGTAGTA 000640
000641 ATGAACACCA GGAAACCTGG GTAGGAGTGT GCATGGCATT CTTCATCACC GCTTGGACTG CATGGCACTG AATACCCACG 000720
000721 GAGAGCAGGA TGGAGAAACA GTGTGCTCAT ATTCACAGGA TGGAATCTAG CCATTCACAA AAATTCCAAA ACAGGCAAAA 000800
000801 TTAAACTGCA TTCTTTAGGG AAGCATCATT AAGTAGTAAA TAATTGACAG AAGGGCAAGA AGGTGCTTAC TCTAAGTGTC 000880
000881 AGAATGGTGG ATACAGCTGG GGGTGAGAGG GCTGTGACCA CAGCAGGGCC CCTGGGGGAT TTGGGGGTGC CAGGCCTGTT 000960
000961 CCTTCCTGCA ATGGTGCCCT TTGGCAGCCA TCCCTTAAAC TGCACTTTTA CTTTATATGC TTTTCTGTAC CTTTACTGTA 001040
001041 GTATTTCACG GAAATTTTTA AATAATCATG AATGTTACCA CTTTCCTATT TATGAACCAT GCAACCTCAT CAATCTTCCC 001120
001121 AGTTCGCAGA TGCCCACCCT CTCTCTCTGC CCCTGTCTCC TTCACATATC CCCAAAACTC GTTTTGGCCC GAAATCCCTG 001200
001201 AGGCCCAACT GCCCTGCTGT CAGCGACTGC ACGCCTCAGC AAAGGCCCAG AAGGCTCTGT CATCACTGGC TGCCCTCAGC 001280
001281 CCGCCTTCAG CTCCTTTGAG CGCTGTGTTG GGGAACTTTG TTGCAAGGAT TTCGTTCCAG AAGGATCCTG ATGCTTTGAT 001360
001361 AAGACCGTGG GCTCTAATCA CAGCCAGGGA CATTTGCAGC AGCCTGGCCT GCAGCTCTGC ACACTGGGTG CACTCAGTCT 001440
001441 AAAGCACCAG CTCCCCATGA GAGAGAAAGA AGGGGTGAGG GGAAGTACAG AGAAAGCTCC TGAGGCCACA GGGCTGACAA 001520
001521 AGCCCTCGGC TTTGGGGGCA CTTTGTTTCT TCAAGACTAA AATGCAGGCA ATGGAATAAA TCATTTGTTC CTAAAACATG 001600
001601 TTCTGCACAT GATTAAAGCA GCTTTGGGAA GTCAAGTAAA TTGGGAAGCA CTGGATCAAA CAATGATAAA TAAGTTTATT 001680
001681 GTCTGCAGGC CTTCTCAGAG CCTGTAGCAA GGTGAGAAGA ATCATGCTTC TACAAAGAGG AAGGA
[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "Lnc-CHRAC1-2:1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=Lnc-CHRAC1-2:1&oldid=1272226 (Last update: Jun 30, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu1.559119110.8162016-06-25 14:20:31[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.35135012016-06-30 20:24:08[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox