LINC00850

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "LINC00850" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=LINC00850&oldid=1272403 (Last update: Jul 02, 2016). [See details]

LINC00850 spanning nearly 50kb on Xq28 specially expressed in brain, which indicated a potential role in mental retardation.

Contents

Annotated Information

Name

LINC00850:long intergenic non-protein coding RNA 850(HGNC nomenclature)

KUCG1[1]

Characteristics

Schematic description of the gene and X-chromosome [1].

LINC00850(alse named KUCG1) spans nearly 50kb onXq28 and is located 9.0kb downstream of MAGEA1 and 4.4kb upstream of MAGEA8. It has three exons separated by two introns(32kb and 20kb long, respectively). Its intron 1 encompassed the site of recombination of the intrachromosomal inversion inv(X)(p21.2; q28), which cause a a head-to-tail fusion of KUCG1 and dystrophin at the recombination sites. Exon 3 of KUCG1 overlaps with antisense transcript RP5-869M20.2, an lncRNA of unknown function.[1]

It belongs to the category of "Intergenic" in lncRNA classification.

Function

KUCG1 disruption may responsible for the moderate mental retardation in the index case as it was expressed in the brain.[1].

Diseases

  • Duchenne muscular dystrophy

Expression

KUCG1 was specially expressed in brain.[1]

Primer used as follows

Primer name Sequence(5'-3')
Dystrophin cDNA
Exon 18r GCAGAGTCCTGAATTTGCAATC[1]
Exon 19f CATTCACCATCTGTTCCACCA[1]
5'-RACE
c24r CAGCCATCCATTTCTTCAGG[1]
c21r TTGTCTGTAGCTCTTTCTCT[1]
c20r ACTGGCAGAATTCGATCCAC[1]
3'-RACE
c16f CTGATCTAGAGGTACCGGATCC[1]
c18f GCAGAGTCCTGAATTTGCAATC[1]
KUCG1 mRNA
Bf GGTGAACCCCTCAATGTAAG[1]
Cr CTCTTGTATTCGCTGCAGTG[1]
Cr2 CAGCAAACTTGTACAGTTGC[1]

Sequence

>gi|565324244|ref|NR_109813.1| Homo sapiens long intergenic non-protein coding RNA 850 (LINC00850), long non-coding RNA

000001 AACCTAGCTT AAAGGATCCT CACATAGTGT GGCAACAACT CTGTGCACAG ACCAAGGAAG GAGAAGCTGT GGGAGCTGGT 000080
000081 AAAATATTTC CTTGGTGGTC AGGACCAAGG CTGGAGGTGA ACCCCTCAAT GTAAGTGTCA AGGGACAACA TTCCTGCCTG 000160
000161 ATATGTGAGC CAATCAGGAG TTCACTACAA TCCGTGAAGC CATAACCAGG GACATTCAAA CTGCAAACCA GGCTGCAGTG 000240
000241 AATGCTGAAA TGAAAAAGAG AGCTATGGAT ATCAAGATGA AAAAGAGGTA TGAAGATTGA AAAGAAATAG ATCATATTTT 000320
000321 TCACAATATG ACCATCAAGA AAATTCAAAG GAAGAGACAC ATGGAACATT CAAATGAATA AGAGACTTCA GAAGACAGCA 000400
000401 TACAAAGACC ACTGCAGCGA ATACAAGAGA CTTGTCACAG ATGAGCAACT TAGAACATAA AATGAAAAAT ATACCATCCC 000480
000481 CAACAGCATT TAAATCCAAA ATATAAAGAA GAAGAAGCCT AACCAAAATA TGCAAGACAT TTACAGAAGC AACTGTACAA 000560
000561 GTTTGCTGAC AGATTCAGAG AAAAAATTCC CAAATAAATG GAGTAGTATA TGATGTTCAC TGATGAGGAA TAGAATACAG 000640
000641 CAAAGGTGTA AATCTTACTT AAATTAAATA AACAGTTAAT GCCTA

Labs working on this lncRNA

  • Department of Pediatrics, Kobe University Graduate School of Medicine, Kobe, Japan.[1].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Tran TH, Zhang Z, Yagi M, Lee T, Awano H, Nishida A, et al. Molecular characterization of an X(p21.2;q28) chromosomal inversion in a Duchenne muscular dystrophy patient with mental retardation reveals a novel long non-coding gene on Xq28[J]. Journal of human genetics. 2013,58(1):33-9.
Please cite: Chunlei Yu (2016) lncRNA: "LINC00850" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=LINC00850&oldid=1272403 (Last update: Jul 02, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu3.547235720.9932016-07-02 11:28:13[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.0071712016-06-30 13:59:20[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox