HEIH

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "HEIH" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=HEIH&oldid=1272191 (Last update: Jun 30, 2016). [See details]

HEIH is oncogenic lncRNA that promotes hepatocellular carcinoma progression.

Contents

Annotated Information

Name

HEIH: hepatocellular carcinoma up-regulated EZH2-associated long non-coding RNA(HGNC nomenclature)

HCCAT2, "hepatocellular carcinoma associated transcript 2 (non-protein coding)", "highly expressed in hepatocellular carcinoma long non-coding RNA", LINC-HEIH, LINC00848, lncRNA-HEIH, "long intergenic non-protein coding RNA 848"[1]

Characteristics

HEIH, a long non-coding RNA ,which showed EZH2-associated upregulation in hepatocellular carcinoma[1].

Function

The expression level of lncRNA-HEIH (lncRNA High Expression In HCC) is higher in HCC tissues and high lncRNA-HEIH expression in HCC had a significantly worse prognosis than those with low lncRNA-HEIH expression that suggested lncRNA-HEIH may act as an independent prognostic factor for overall survival in HBV-related HCC [1].

Moreover, lncRNA-HEIH is associated with enhancer of zeste homolog 2 (EZH2) and this association is required for the repression of EZH2 target genes(p15, p16, p21, p57).[2].

Regulation

It suggested that lncRNA-HEIH up-regulation in HCC is mediated by the transcription factor, SP1[1].

Diseases

  • hepatocellular carcinoma (HCC)[1]

Expression

The expression level of lncRNA-HEIH (lncRNA High Expression In HCC) is higher in HCC tissues [1]

Oligonucleotide Sequences used in this study

Gene Sequences
lncRNA-HEIH 5' GGTAGAAAAAGCAACCACGAAGC3'[1]
5' ATGGCTTCTCGCATCCTAT 3'[1]
shRNA sequence
LV-shRNA-1 5’-TGCGCCTTCCCTCTAACCTTAATTCAAGAG[1]
ATTAAGGTTAGAGGGAAGGCGCTTTTTTC-3’[1]
LV-shRNA-2 5’-TGGCAAGATGAACGTCTGAAATTTCAAGA[1]
GAATTTCAGACGTTCATCTTGCCTTTTTTC-3’[1]

Sequence

>>gi|365733597|ref|NR_045680.1| Homo sapiens hepatocellular carcinoma up-regulated EZH2-associated long non-coding RNA (HEIH), long non-coding RNA

000001 GTCCCCGCCC CCTGCTGGGC CTCTCTCCGC AGCCGCGAGA CCCGCGCTTG GCGCATAGGC CGGTTCTAAT TTACAAGAAC 000080
000081 ACCGCGGCCT GAGGCCGGAG AGTCCCTTCA ACCCGGGAGG CGGCGGCTGC AGGGAGCCGA GACGGCGCCA TTGCCCTCCA 000160
000161 GCCTGGGCAA AAAGAGCGAA ACTCCGTCTC AAAAAAAAAA AAACATGGCC GAAACCAGGA AGCTGCGCGA TGGCGCCACG 000240
000241 GCCCCTCTTC TCCCGGCCTG TGTCCGGAAG GTTTCCCTCC GAGGCGCCCC GGCTCCCGCA AGCGGAGGAG AGGGCGGGAC 000320
000321 GTGCCGGGGC CGGAGCTCAG AGGCCCTGGG GCCGCTCTGC TCTCCCGCCA TCGCAAGGGC GGCGCTGACC TGAGGCCTCC 000400
000401 CCGCAAAGGT CCCCGAGGCG GCGGCGGCGG CGGGCTGTGA GAACCGCAGA AGAACGCTGG GCGCGCAGCG ACCCGTCCAC 000480
000481 CCCCGCGAGG AGAGACTTCC ACAGAGGCAG CGTTTCCACA GCCCAAAGCC ACGTTTCTAG GGTGATGCAG CCCCAGTAAG 000560
000561 TTCCTGGCGG GGAAGCTCAC GGCTGTCAAA AGAACTCTTC GCTCCAGCCG GCGCACGAAG GGGAGGAGGG CAGGAGGCTG 000640
000641 CCGCCCGCAC AGGTCATCTG ATCACGTCGC CCGCCCTAGT CTGCTTTTGT GAATCTCCAC TTTGTTCAAC CCCCACCCGC 000720
000721 CGTCTCTCCC TCCCTGCGCC TTCCCTCTAA CCTTAAAGAC CCAGCTACCT CTACGCAAAT GGTAGCTACC TCTGCGCAGG 000800
000801 TGGAAGTTGA GTTCGGTTCA CGCGGGACCC TCTTCCCTGT GGCAAGCTGC TGAAGGAGAC CTGCTGTTAC TGCTTTAGCT 000880
000881 GCTGTTCTGC TTAATCTCAG ACAGCTGGAA GGTAGTATTC CGCCCTCGCC CAGCCACCCG AGTAAATGAG AATGATGACT 000960
000961 GACTGAGACC CTGATGGTGG TGGCTTAGGC TTAATCTCAG ACAGCTGGAA GGTAGTATTC CGCCCTCACC CAGCCACCCG 001040
001041 AGTAAATGAG AATGATGACT GACTGAGACC CTGATGGTGG TGGCTTAGGC AAGATGAACG TCTGAAATGG AGGCCCAGGG 001120
001121 CTGCCACGAT GGCTCTGTAG TCATCAGGGA GGGAGCTCCT TTTATCTTGT TACCTACTCC CCTCTTGTGC CCCTTTCTTC 001200
001201 CCTTGATCTA AGAAGGTTGC TCCGGATCTC GCCATCTGGC CTGCGTTCAA TCAGCAGAAG CTTCCTGGAG GAGCAGGAGG 001280
001281 AGGCACTGTG CTCGCATCAC ATACCAGTGG CCAGAAGTTG GCTTCAGGGA AGCTCAGGAA ATAGGATGCG AGAAGCCATG 001360
001361 AGACCTCCCC AAACTCTGCA GTAACAGAGT CAACAAGACA ATGGCTTAAA GATGGAGAGA CCAGTTGATC GGTCACACAA 001440
001441 GCTGTTCCAC GATAATTCTT GTGTCAGAAG GGGAGGCTGA CTACCAGGAC CACTGGCCCC ACTTCCAGCC CCTCCATTCT 001520
001521 GAGTACACTT CAGAGGGCTC TGGCAGGGTG AGGGGGTCTT GGTGGTGCCA CAGAGAGTAA AGGTCTAGCA CACCCATTGT 001600
001601 GGAGATATTT CATGGGGACA ACCCAGTGAC TTCACTTGAA GTAAAGTGGG ATTTTCCAAC CTTGAAAAAA AAAAAAAAAA 001680
001681 A

Labs working on this lncRNA

  • Departamento de Bioqu′?mica, Instituto de Qu′?mica, Universidade de S?ao Paulo, 05508-900 S?ao Paulo, SP, Brasil [1].
  • School of Pharmacy, Anhui Key Laboratory of Bioactivity of Natural Products, Anhui Medical University, Hefei 230032, China; The Key Laboratory of Anti-Inflammatory and Immune Medicine (Anhui Medical University), Ministry of Education, China; Institute for Liver Diseases of Anhui Medical University (ILD-AMU), Anhui Medical University, Hefei 230032, China[2].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Yang F, Zhang L, Huo XS, Yuan JH, Xu D, Yuan SX, et al. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans[J]. Hepatology. 2011,54(5):1679-89.
  2. 2.0 2.1 He Y, Meng XM, Huang C, Wu BM, Zhang L, Lv XW, et al. Long noncoding RNAs: Novel insights into hepatocelluar carcinoma[J]. Cancer letters. 2014,344(1):20-7.
Please cite: Chunlei Yu (2016) lncRNA: "HEIH" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=HEIH&oldid=1272191 (Last update: Jun 30, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu5.01150180.9982015-04-10 13:55:33[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.0041412016-06-30 19:47:15[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox