ENST00000607033.1

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "ENST00000607033.1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=ENST00000607033.1&oldid=1272024 (Last update: Jun 29, 2016). [See details]

TARID,shorted for TCF21 antisense RNA inducing promoter demethylation, spanning 3002 bp in 6q23.2, may function together with GADD45A, TDG, and TET proteins as part of a surveillance mechanism that protects TCF21 from hypermethylation and transcriptional silencing.

Contents

Annotated Information

Name

TARID: TCF21 antisense RNA inducing promoter demethylation(HGNC nomenclature)

Function

TARID interacts with both the TCF21 promoter and GADD45A (growth arrest and DNA-damage-inducible, alpha), a regulator of DNA demethylation. [1]
Model Depicting the Role of TARID in Regulation of TCF21[1]

TARID interacts with both the TCF21 promoter and GADD45A (growth arrest and DNA-damage-inducible, alpha), a regulator of DNA demethylation. GADD45A in turn recruits thymine-DNA glycosylase for base excision repair-mediated demethylation involving oxidation of 5-methylcytosine to 5-hydroxymethylcytosine in the TCF21 promoter by ten-eleven translocation methylcytosine dioxygenase proteins, which reveals a function of TARID, serving as a genomic address label for GADD45A-mediated demethylation of specific target genes[1].

Expression

RT-PCR Forward Reverse
TARID CGGTCACCACTTCTTTCAGG CGTATGTGAAGACAAAGGCAAC
RT-qPCR Forward Reverse
TCF21 CATTCACCCGGTCAACCT TCAGGTCACTCTCGGGTTTC[1]
TARID AAATGAAGACAAGTGCTTCCTAGAAT TTAGGGTGGATGTGGTCATTTA[1]
HPRT1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT[1]
SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG[1]
rRNA AGTCGGGTTGCTTGGGAATGC CCCTTACGGTACTTGTTGACT[1]
GADD45A GAGAGCAGAAGACCGAAAGG TGACTCAGGGCTTTGCTGA[1]
GADD45B AGTCGGCCAAGTTGATGAAT CCTCCTCCTCCTCGTCAAT[1]
XPA GACACAGGAGGAGGCTTCATT GCTTGTGTTTATCATCAGCATCTC[1]
XPC TAAAGGGGTCCATGAGGACA TGGCTGCAGATGTTATTTCG[1]
XPF CCACTGACACTCGGAAAGC CACGCATATCCACAACTATGC[1]
XPG TGAATCTCTGTTTCCTGTATTAAAGC AAGGAATCAATTCGGAGCTG[1]
TDG ATGCAGCAGTGAACCTTGTG GGAATTTGGTCTGTAAATGACTGG[1]
TET1 TGTTGTGCCTCTGGAGGTTA TCTGACTTGGGGCCATTTAC[1]
TET2 TAGAAAGGAGACCCGACTGC AGGGTGTGCTGCTGAATGTT[1]
TET3 AAGTAGGGCAACTGGGCTTT GGACAATCCACCCTTCAGAG[1]

Labs working on this lncRNA

  • Institute of Molecular Biology (IMB), 55128 Mainz, Germany; Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany[1].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 Arab K, Park YJ, Lindroth AM, Schafer A, Oakes C, Weichenhan D, et al. Long noncoding RNA TARID directs demethylation and activation of the tumor suppressor TCF21 via GADD45A[J]. Molecular cell. 2014,55(4):604-14.

Basic Information

Transcript ID

ENST00000607033.1

Source

Gencode19

Same with

'

Classification

antisense

Length

2960 nt

Genomic location

chr6-:133823390..134210120

Exon number

9

Exons

133823390..133823818,133827217..133827408,133828382..133828459,133856918..133858496,133889328..133889386,134081323..134081398,134089969..134090061,134167015..134167089,134209742..134210120

Genome context

Sequence
000001 CAGACCCTGA TTTGCAACTT GTAATGTAAA TCAACTCAAC TGCATCATGT ACTTACCAGC CACCTTCTCC CAACTGTGGC 000080
000081 CGGGGCCGAG AAGCAGCATG TTCTGTCCAT CTGTAAAAGG CCTTCTTTCT CTCTTAAGAC GTCACAACTG GTTGTTACTG 000160
000161 AGAACTTTAG AAAAACGACT AGATCGTTTG GCTCTTTCTG GGCCTTCCAC CTACACTCCA TGCCCTCTCT CCTCCCAAGA 000240
000241 AAACACGAAT TAAAATACAG GGAGTATCAA CCGCATCCTG CCAACACCTC ATAAGACTCC AAGGCTTTAC CGAGATCTTC 000320
000321 CACCTTCCCC GGGATAAATG AAGACAAGTG CTTCCTAGAA TCTTTATGGT GATGGAAAAG ATATACTAAA AGAAGACAGA 000400
000401 TCAGTCTCTC TCCTGATAAG AAGAGTCACC AAGAGGAACA TCTGCAACAA CTAGATGCTG CTACAAAGAG ACCAATCAAC 000480
000481 AACTGCTCAG CAGAGATACA GATCTGAAGC ACAGAAGTGC AATAGACCTT CCTGATGCCT TCGCCAGGAG CATGGAATTC 000560
000561 TTCCCAGAGT CACAGAAGAT GGCACAGCCT GGGGACAATT GGGAATCACC TGGAGGATGG CAGACAACAC GAACCTGCAA 000640
000641 GTAATCATCC GACCAACTTC CTCTACTGCT TGGGAATTGC AGGTTGTATA ATCTTGGGAG GTCACTTCAA CTATACAATT 000720
000721 GGACTAAGAA CACTGACTCT CGTGGGTGTT ATAATTAAAT CAGGTAATAT ATGGTAAGGT AAGCATTGAT TAGTCTCTTC 000800
000801 ATTAGTTGAT TAGCCTCTTC AAATGTTAGT TTGATTAGTC TCTTCAAACG TTAGTTTCCT TCCTCTTTTC AGTATGCTCG 000880
000881 CTGAAAAGCT GGCTACAGAG CGAGTGACTG AATCAAAGCA TCACATCCTA CATGCTCCCA TTCCCCATCT TGCTACAGTG 000960
000961 GTACCAGCTT CTGTGCCCAG AAGATGGTGC TGTGGTTGGA TGAATAAAAC AATTACAGGG CCTTCAAGGA TAAGAAGAAG 001040
001041 GAACATGGAT AAATATCCCC ATTCTGCCTA GACAGAAATA AGAAAAACAT TCCCTTTTCT CTTCTTTAAA ACGAATTCTT 001120
001121 GAGTCATGCA TGGCAACAAT ATGTGTTGCC AAAAGTGGCC AGTTTGTGGT AGTAGGTTTT ATTCAGAAAA TCAGTGGGTG 001200
001201 ATGAAAATTT AGAAGATGCA CTCATCATTT GTAAAACTGT AGATGAAAGT TTAAAAGATG ATGTTATACC ACTTTTTCTT 001280
001281 CACTGCCCTC ATCAGTGGCT CCATCCCACC CTCCTGCTGT TCTCATAACT GATGTAGAAA TAATTTCATG AGCCAAACAG 001360
001361 GATGGTTTTA TACGTGTGTG TTTGGCATTA ACTTTATTTC CTATTCACGT ACCAGATATT ACTGCCCGCT CTTATGAAAT 001440
001441 AGTTTATTCC ACCATAAATG TATGTTTTAA TGATCACCAC ATTTTTTTGG AATACATTAA TCTGTCTAAA AATAGGTGAT 001520
001521 TAAATCATCT GTCATTCTGC TGTGAAGCTC TTTAATGTTT TCTTTGGGAA ATAAATTAGA ATGCCATATT GGTTTCCAAG 001600
001601 CAGACATAAG CTGGCGATGA CTTTTTTGTA CAAAAGTTAC TGATGAAAAG CTCATAGAGG CATTTGGATT TCTTCAGGGT 001680
001681 TGTAAATCCA GGTATGTTAC TACTTTATCT ACTGGAAATT GGGGTAATGC AGGAGATGGG AAAGCATGAT GTTAAATCAA 001760
001761 CTGGTGACCC CAAATAATTT TCCATGGTGT TCATCAGCCA TGCACACACT GTATTACTGT CATCATTCCT AGCTTTTCCA 001840
001841 CTATGCTGTC TCAAGTTTGC ACAAATTGTA AGTGATTTTA AATCATTAAC TGATGTGACA TAATCAAATT ACTTAGGGTT 001920
001921 TTATTTACTG TGCTCCGAGT AATTCAGTTA TGACTTGGCA AGGTATTTAA CAGACAATAG TGAAGTTACT ACAAATTCAA 002000
002001 CTTTGCATTG GACAACTCCA TTTGAGGATA CCACCACCTT CAAATTAACA ATTCCAGAAA CTGGTCTCAG TATCTCGTTC 002080
002081 CAACAACAAG CATCACCCAC TACAATAAAA ACAGCAAGTA GAATCTTTTT ACTTCTTTTG TGTTTCTCAT CTCGGCAAAC 002160
002161 TGCACTACAA TCTACCAAAC TGCCCGAGCC AGAAACCTAG AGGTCAGGCT GGATTTTCCT GAGGACATGA GGTGAAGAAG 002240
002241 CAACCACTGC GAAGTACTAA GCAAAGGATG GGTCAGAAGT ATGTGCTCTG GAGCCACGCA AATCTGCTTC AAATTCCAGT 002320
002321 TCTGCCATTT AGATAGCAGG TTATCTACAG ATACAGAAAC CATCTAGGAG GTCTGGTGTT GGATACAACT ATTTGTACCT 002400
002401 TGTAAAATTC TTACCTCTAA ATCATTAAAA AACAAATGAG TATCAGCAAG ATTAAAAATC ATTTCTTCCA TGCGGAGTCC 002480
002481 AAGGGTTACA GCCATGGGGG GATCCTGTAA AGAAAATGTA CACATAATGA GCTTACTAAG TCACTGGGAC AGCTAATTCT 002560
002561 AAGTGAGCAG ATTACAGCAC TGCATTTTTC CAGCTAAAGG ACTCACAGAT CCAAGAATCC CAGAAAGATG ACTGGACATT 002640
002641 TGGTGGGTGT AGCCTTAGCA ATGCTGGGCA CCCTCCATCT TGCCAAACTG CTGTGAGGGA GCTGCCAGCA CCTGCAATTC 002720
002721 CACTGTTTTA TCAGGCATGT GAGAATGAAA CATACTTCTG GATTGAACCC AAGTTTTATA CAGAGATGTT TGCTCATTTT 002800
002801 CATTAGATGT TTGTAGAATT ATGGGCACCT TATGAATCAA GAGTTGCTTT TTTTTAATTT GCATTTAAGT GTAGTGAATG 002880
002881 TTGAGTTTAG GGTCTAAAAT GAGGTGATAG CAAAATCTTG GATAGAGGAA AAAAGTGGGA TAATAAAGGC ACTAACAGGG 002960
[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "ENST00000607033.1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=ENST00000607033.1&oldid=1272024 (Last update: Jun 29, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu3.0351303512016-06-29 21:33:54[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox