ENST00000583516.1

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2015) lncRNA: "ENST00000583516.1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=ENST00000583516.1&oldid=1270685 (Last update: Apr 09, 2015). [See details]

ESRG, which is human embryonic stem cell related gene, may be a new pluripotency marker for undifferentiated hES cells

Contents

Annotated Information

Name

ESRG, embryonic stem cell related (non-protein coding)(HGNC nomenclature)

HESRG, "human embryonic stem cell related gene"[1]

Cellular Localization

ESRG was specifically localized in the nuclei of hESCs [2].

ESRG protein was localized in the cytoplasm of COS7 cells [2].

Function

HESRG gene may be a new pluripotency marker for undifferentiated hES cells [1].

Expression

It is expressed specifically in ovary tissue and undifferentiated human embryonic stem cells (hESCs) [2]. HESRG was apparently down-regulated once differentiation and the mRNA level of HESRG decreased gradually with the time of differentiation. Additionally, the expression of HESRG in teratoma tissues derived from hES cells was totally absent.[3]

Primer name Primer sequence(5' to 3')
RACE-PCR primers
5'-GSP 5'-CCCCCTCCAGGTACCAGAAC-3' [2]
GeneRacer5'primer CGACTGGAGCACGAGGACACTGA [2]
3'GSP AAGCAGTGGTATCAACGCAGAGT [2]
UPM ctaatacgactcactatagggcAAGCAGTGGTATCAACGCAGAGT [2]
ORF cloning primers
ORF sense CTGACTCTCTTTTCGGACTCAG [2]
ORF antisense TGAAAATAAGCGATTGGGGGGTT [2]
Gene-specific primers for RT-PCR
GAPDH forward CTTTGGTATCGTGGAAGGACTC [2]
GAPDH reverse CTCTTCCTCTTGTGCTCTTGCT [2]
ESRG forward ATGAAAGGGAAGACATACAA [2]
ESRG reverse TGAACATAGCAAGGGAAA [2]
ESRG-B forward TGAAAGGGAAGACATACAAAAAC [2]
ESRG-B reverse GAACATCTCCAGAACAACCTCACAG [2]

Labs working on this lncRNA

  • Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Key Laboratory for Carcinogenesis of Chinese Ministry of Health, Changsha, Hunan 410078, PR China. [2].
  • Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, 110 Xiangya Road, Changsha 410078, Hunan, and Department of Neurosurgery, Xiangya Hospital, China [3]
  • Department of Neurosurgery, Xiangya Hospital, Central South University, 87 Xiangya Road, Changsha, Hunan 410008, China [1]

References

  1. 1.0 1.1 1.2 Wanggou S, Jiang X, Li Q, Zhang L, Liu D, Li G, et al. HESRG: a novel biomarker for intracranial germinoma and embryonal carcinoma[J]. Journal of neuro-oncology. 2012,106(2):251-9.
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 Li G, Ren C, Shi J, Huang W, Liu H, Feng X, et al. Identification, expression and subcellular localization of ESRG[J]. Biochemical and biophysical research communications. 2013,435(1):160-4.
  3. 3.0 3.1 Zhao M, Ren C, Yang H, Feng X, Jiang X, Zhu B, et al. Transcriptional profiling of human embryonic stem cells and embryoid bodies identifies HESRG, a novel stem cell gene[J]. Biochemical and biophysical research communications. 2007,362(4):916-22.


Basic Information

Transcript ID

ENST00000583516.1

Source

Gencode19

Same with

lnc-LRTM1-3:1, ESRG,HESRG

Classification

intergenic

Length

3140 nt

Genomic location

chr3-:54666149..54673884

Exon number

4

Exons

54666149..54666834,54667586..54667767,54668488..54668592,54671718..54673884

Genome context

Sequence
000001 GCTGACTCTC TTTTCGGACT CAGCCCGCCT GCACCCAGGT GAAATAAACA GCCTCGTTGC TCACACAAAG CCTGTTTGGT 000080
000081 GGTCTCTTCA CACGGACGCG CATGAAATTT GGTGCCGTGA CTCGGATCGG GGGACCTCCC TTGGGAGATC AATCCCCTGT 000160
000161 CCTCCTGCTC TTTGCTCCGT GAGAAAGATC CACCTACGAC CTCAGGTCCT CAGACCAACC AGCCCAAGAA ACATCTCACC 000240
000241 AATTTCAAAT CCGGTAAGCG GCCTCTTTTT ACTCTGTTCT CCAACCTCCC TCACTATCCC TCAACCTCTT TCTCCTTTCA 000320
000321 ATCTTGGCGC CACACTTCAA TCTCTCCCTT CTCTTAATTT CAATTCCTTT CATTCTCTGG TAGAGACAAA AGAGACATGT 000400
000401 TTTATCCGTG AACCCAAAAC TCCGGCGCCG GTCACGGACT GGGAAGGCAG TCTTCCCTTG GTGTTTAATC ATTGCAGGGA 000480
000481 CGCCTCTCTG ATTTCACGTT TCAGACCACG CAGGGATGCC TGCCTTGGTC CTTCACCCTT AGCGGCAAGT CCCGCTTTCC 000560
000561 TGGGGCAGGG GCAAGTACCC CTCAACCCCT TCTCCTTCAC CCTTAGCGGC AAGTCCCGCT TTTCTGGGGC AGGGGCAAGT 000640
000641 ACCCCTCAAC CCCTTCTCCT TCACCCTTAG CAGCAAGTCC CGCTTTCCTA GGGGGCAAGA ACCCCCCAAT CGCTTATTTT 000720
000721 CACGCCCCAA CCTCTTATCT CTGTGCCCCA ATCCCTTATT TCCACGCCCC AATCTCTTAT CTCTGCGCCC CAATCCCTTA 000800
000801 TTTCCGCGCC CCAACCCTTT CTCTGCTTTT CTGGAGGGGA AGAAACCCCC ACCCCTTCTC CGTGTCTCTA CTCTTTTCTC 000880
000881 TGGGCTTGCC TCCTTCACTA TGGGCAAGCT TCCACCTTCC ATTCCTTTCT TCTCCCTTAG CATGTATTCT TAAGAACTTA 000960
000961 AAATCTCTTC AATTCTCACC TGACCTAAAA TCTAAGCGTC TTATTTTCTT CTGCAATGCC ACTTGACCCC AATACAAACT 001040
001041 CAACAGTAGT TCCAAATAGC CAGAAAATGG CACTTTCAAT TTTTCCACCC TACAAGATCT AAATAATTCT TGGCGTAAAA 001120
001121 TGGGCAAATG GTGTGAGGTG CCTGACGTCC AGGCATTCTT TTACACATCA GTCCCTTCCT AGTCTCTGTG CCCAGTGCAA 001200
001201 CTCGTCCCAA ATCTTCCTTC TTTCCCTCCC GCCTGTCCCC TCAGTACCAA CCCCAAGCGT CACTGAGTCT TTCTAATCTT 001280
001281 CCTTTTCTAC AGACCCATCT GACCTCTCCC TTCCTCCCCA GGCTGCTCCT TGCCAGGCCG AGCTAGGTCC CAATTCTTCC 001360
001361 TCAGCCTCTG CTCCTCCACC CTATAATCTT TTTATCACCT CCCCTCCTCA CACCTGCTCC GGCTTACAGT TTCATTCCGT 001440
001441 GACTAGCCCT CCCCGACCTG CCCAGCAATT TATTCTTAAA AAGGTGGCTG GAGCTAAACG CATAGTCAAG GTTAATGCTC 001520
001521 CTTTTTCTTT ATCCCAAATC AGATAGTGTT TAGGCTCTTT TTCATCAAAT ATAAAAATCT AGCCCAGTTC ATGGCTCGTT 001600
001601 TGGCAGCAAC CCTAAGACAC TTTACAGCCC TAGCCCCTAA AAGGTCAAAA GGCCATCTTA TTCTCAATAT ACATTTTATT 001680
001681 ACCCAATCTG CTCCCGACAT TAAATAAAAC TCCAAAAACT GGAATCTGGC CCTCAAACCC CACAACAGGA CTTAATTAAC 001760
001761 CTCACCTTCA AGGTGTGAAA TAACAGAAAA AAGTTGCAAT TCCTTGCCTC CACTGTGAGA CAAACCCCAG CCACATCTCC 001840
001841 AGCACACAAG AACTTCCAAA CGCCTGAACT GTAGCAGCCA GACGTTTCTC CAGAACCTCC TCCCCCAGGA ACTTGCTACA 001920
001921 CATGCCGGAA ATCTGGCCAC TGGGCCAAGG AACGCCCGCA GCCCGGGATT CCTCCTAAGC CGCGTCCCAT CTGTGTGGGA 002000
002001 CCCCACTGAA AATCGGACTG TTCAACTCAC CTGGCAGCCA CTCCCAGAGC TCCTGGAACT CTGGCCCAAG GTTCTCTGAC 002080
002081 TGACTCCTTC TTGGCTTACT GGCTGAAGAC TGACGCTGCC TGATCGCCTC AGAAGCCCCG CAGACCATCA TGGACGCCGA 002160
002161 GCTTTAGCCC GCCTGCACCC AGGTGAAATA AACAGCCTTG TTGCTCACAC AAAGCCTGTT TGGTGGTCTC TTCACACAGA 002240
002241 CGCGCATGAA AGGGAAGACA TACAAAAACA AGGCCTCTGA GGTAGGTACT ACTGAGACAG CCAGGTGGGA AGGACTCCTT 002320
002321 GGCAAAACTC CAACCAGCCT GTACACTGGG AGGAATGTGC ACTGGGATGG AGCCATAGAA GTTTGTGTCG TTTGCAGTGG 002400
002401 GGAGGAGCCT GGTCCCTCCT CTTCCTGTGA GGAACCTGGA ATTCAATCTG TGAGGAACTT CTTGAAAGAC CCATCAATTC 002480
002481 TTCAATAGAA AGCATCAAAG GACAATTTAC ACCCTAAGAC TGAACCCCTG ACCTCAAAAT CTTTCCCTTG CTATGTTCAC 002560
002561 CAACCTCAAC AGAAATATTA GGATTCTTAC CTGATCCTAG CCAAGCCCCC TCCCTCATCT CCCATTAAAG GGTCCATCTT 002640
002641 CAACCAAACT TAAGTCTCAA TAAATATCTG GACATTGTCC TTCCAACTCT GGGAAGCTGC TAAGACTCTG TCCTTACTGC 002720
002721 AGAAGAAAAA ACAGCCTTGT ACCCTGGTCT TCTCAACAGG TTGTTCTGGA GATGTTCTGG GGAGACTGCA TTAAACACAG 002800
002801 CTTCGCACCA TTGAATAAAC TCAGCAACAA GCCAATGCAT AAAAGTAATC TATGCTTCAG GTCACAGAAG CTTCAAGGGG 002880
002881 AAAAAAACAG AATACTCTAG GGCCATTGTT CACAAACTCA TCTGAAAACA TCCTGGAAAA ATTTTCCCAA ACACATGGAA 002960
002961 AGAAAGAGAG GAAAAAAGAA GATATCTGAA TAATGTGGAC TAGAATAAAG AGCTGCCAGG AGCTGTTTAT TTAAAAACAG 003040
003041 TACTTTCTTC TCTGGCTGAG TCCCTGGTAT TCTCTGCTGC AATCTGTAGC TGTAGAATTT TGAAGAATGC AATTAAATTC 003120
003121 AAATGGTTTG ATGAGTAATA
[back to top]
Please cite: Chunlei Yu (2015) lncRNA: "ENST00000583516.1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=ENST00000583516.1&oldid=1270685 (Last update: Apr 09, 2015).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu3.0261302612015-04-09 21:58:52[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox