ENST00000574306.1

From LncRNAWiki
Jump to: navigation, search

Homo sapiens MIR22 host gene (MIR22HG), transcript variant 1, long non-coding RNA.

Contents

Annotated Information

Name

MIR22HG: MIR22 host gene (HGNC nomenclature)

DKFZp686O06159, MGC14376[1]

SYNONYMS

DKFZp686O06159, MGC14376

Cellular Localization

  • nuclear

Function

MIR22HG plays a role in cellular defense mechanisms against specific stressors, and has the potential to be surrogate indicators for cellular stress response[1].

Expression

RT-PCR primer as follows:

Primer Forward Primer Reverse Primer
MIR22HG CGGACGCAGTGATTTGCT GCTTTAGCTGGGTCAGGACA[1]

Labs working on this lncRNA

  • Research Institute for Environmental Management Technology, National Institute of Advanced Industrial Science and Technology (AIST), 16-1, Onogawa, Tsukuba, Ibaraki 305-8569, Japan[1].

References

  1. 1.0 1.1 1.2 1.3 Tani H,Torimura M.(2013)Identification of short-lived long non-coding RNAs as surrogate indicators for chemical stress response.Biochemical and biophysical research communications.439(4):547-51

Basic Information

Transcript ID

ENST00000574306.1

Source

Gencode19

Same with

lnc-TLCD2-1:3,MIR22HG,DKFZp686O06159,MGC14376

Classification

intergenic

Length

2626 nt

Genomic location

chr17-:1614805..1619545

Exon number

2

Exons

1614805..1617308,1619424..1619545

Genome context

Sequence
000001 AGCTGATCGG AGCCTGGAGC CGGTGTGTGC TGGGTGCCGA GAAGAGACAG CGCCGCCGGC CGTGGGGAGC GGACGCAGTG 000080
000081 ATTTGCTCCC CCTCGTGCAG CAACCCCCAC ACCCAGCACC AGGAGCCTGT TCCTCTCACG CCCTCACCTG GCTGAGCCGC 000160
000161 AGTAGTTCTT CAGTGGCAAG CTTTATGTCC TGACCCAGCT AAAGCTGCCA GTTGAAGAAC TGTTGCCCTC TGCCCCTGGC 000240
000241 TTCGAGGAGG AGGAGGAGCT GCTTTCCCCA TCATCTGGAA GGTGACAGAA ATGGGCTGGG AAGGTCCGAA CAGCAGGGTG 000320
000321 GATGATACGT TTTGGGCAAG TTGGAGAGCC TTTGCCCAGA TTGGCCCAGC AAGGAGCGGT TTTAGATTAG AGACACTGGC 000400
000401 TGGATTGAGG AGTAGAAGGC TCAAACAACC CAAGGTTAGT TGGTCTTTGT GTGACAGTGG GAAGAAGTGG AGAGAACACT 000480
000481 CTGTCTCCCC GACTTCCTTC TTGACCCTCC TTCCGTATCT TTCATTCTTC CCCACTGGCC TTTCCAGATG AGGTCCAAAA 000560
000561 GTAAGCTCAC TCTTCAGGGA AAAGTGATAC TAAACCCAGG CGTGAGGAGT CATCCTTCTG CTCTTACTTT TCCCTGCATT 000640
000641 TCCTTAGGCT GGCCCAGACT CTAGATTCCT GGGCACTTAC CTGTATCTGA GACCCTTAGA CCTCCTGTCT CAGTTTCTCC 000720
000721 ACCTGTGAGA TGGGCAGTCA CACAGATGAG TGTGCATGAG GGAATCAGAA GCCCATCTGG GTTGACTCAG AACCCGGGCT 000800
000801 CTCCCCCTGC TGTGGGTGGA AACAAAACAC CTTTTCACAG AAGCTGTTGT CCCTCCCCCA TCCCTGATAC CATCACCCAG 000880
000881 AAGCTGGGTG GGGAATGGGA AGCTGGAGGA GGGGGTTAGA GTTAGACCAA TGCGAGGAGC TAGTAAGAGC TCGCCTCTCC 000960
000961 GTGACTTCCC CCCATGCAAG GGTGGCCCAA GGCTTCCCCT GATATCCAAA GCAGGACAGC AGCCCCTTGG TGGGATTCTA 001040
001041 ACTGCTGCTA CTCTGTTTCT TTCCTCACTT TGCTTTCCAA GGTGGTATGT GATCCCCAGC TCAGGCCTGT GCAGACAGGA 001120
001121 AATTCTCCCC TGCAGCAAGT AGGGGAGGTG GGTTGTGGGA TGTGACCTCC TTCCAGATAT CAGGCAGTGA GTGTAAACCT 001200
001201 GCCACCTCCA GCCCTGATCC ATTCTCACCT AGCGGCTACA GGAAGCTGTG TCTGTTCGAT TTGGTGGGAG GAGATGTGCA 001280
001281 GGGAGCTGTA TCTTGTCCTC CGCTTGTGAA AAACTCAAGG ATGTGGAGAA GAGTAGACCG TGGAACCCTG CTCTTCTGCA 001360
001361 GCCAAGCTGA GGGGCAGGAT GCGTGTGGGA CAGTGGTAGA GAAGCAGGGG ATAGACTCAT AGGCTGCAAC AAAGGTGACT 001440
001441 CTGTCCCTGG ACACTGCCTC CGTACTTTCT CCTTGCTTCA CTGGCCACAG CATCTCCCTC CAGCCCTCGC TATGTGCCTC 001520
001521 TGCCATCTTC ACCCATCATG GAGCAGAGGT GAGGAGAGGC AGCCTGGGAA TATGGAGACC AGTGAAGGAC CAGGCCTGGA 001600
001601 GAGCACAGGG TCCTACCTGG GCATCCAGCA GAGGAGCCCC TAAAGGCCAG GAGCACCCCA AGAGGAGGGA GGGCAGCCAG 001680
001681 CCTCCATTGA CGGCGAGCCT CCAGCCCTCT CCTACTTTGA TCACCATTTC TCTCCAGGCT TTCTGCCTCC GAGATGTGGC 001760
001761 ACCATAGTGC GGTGCCCTGT GGCTTCACCG CCCTACTTCC ACCTCCGCCC AGCCTGTAAT GTTTATATAA GCAGCCTCAA 001840
001841 GGACCAAGAA CCATCTGCGA AAGGACACAC ACAGGAAATT CATAAAAGAA ATCTGAATGG ATAAAACCAT GAAAAAAAGT 001920
001921 ATGCTTCATT AGTAATTAAA GAAAGGCAAA TAGAGCTGGA AGCATTTTTC CCTTAGCAAA CCATAACAGA AAAAAATAAG 002000
002001 ACCCAATATT GGCAAAGAGA CTACTGAAAA AACATTCCCA TACATTGCGT GTGGGAGTAT ACATCGGTGC AGGCTTCCTG 002080
002081 GATGACAGTT GGGTGATATG TGTCATGTGG CCTAAAAGCC TCCATGTCAT TTGACCTACG AATTCTATCT TTGGGAATTT 002160
002161 ATCCTAAGAA AATACTTAAG GATTTAGTTA GTGATAAGAT GTTCATCCCA GCATTGCAAT GGAGAAAAAT GGGAAGCAAT 002240
002241 GGTTTGGTTG GGAATTTATT CCTTTTCTGC TGTAACGAAA GTTTGCAATA GGGGATTGCT TAAGTAAATT ATTGTATCTC 002320
002321 CATCCAGATG GTGGAGTACC GCGCAGACAT TAAAAGTCAT GTAAAAGAAC ATCTGACTGA AAGAAAAATG CTCCTTGAAT 002400
002401 ATTAAAAGGT TGTAAAAATA GTGCATGTTA TGTGATTTCA ATTTTGTTTT TTAAAATATG GGTGTATGCT TGTATACGTA 002480
002481 GAGCAGATAA AAAAGACGGA AGGCATACTA AAAAATGTTG AGTGGTTATC TTTGTATGGT GGAACAAAGT CACTGTAATT 002560
002561 TTCATCTTTG GTTTTTCTGT AATTTCCAAA TTTTCCACAT TTTGTATTTC ATATAATATA ATTTAA
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox