ENST00000561978.1

From LncRNAWiki
Jump to: navigation, search

PCAT1, a novel prostate cancer ncRNA alternately demonstrating either repression by PRC2 or an active role in promoting cell proliferation through transcriptional regulation of target genes.

Contents

Annotated Information

Name

PCAT1:prostate cancer associated transcript 1 (non-protein coding)(HGNC nomenclature)

PCA1, PCAT-1[1]

Characteristics

PCAT-1 resides in the 8q24 “gene desert” locus. PCAT-1 is located in the chromosome 8q24 gene desert approximately 725 kb upstream of the c-MYConcogene[1].

Function

PCAT-1 is a marker of aggressive cancer and a PRC2-repressed ncRNA[1]

PCAT-1 biology may exhibit two distinct modalities: one in which PRC2 represses PCAT-1 and a second in which active PCAT-1 promotes cell proliferation. PCAT-1 and PRC2 may therefore characterize distinct subsets of prostate cancer[1].

PCAT-1 can stratify overall survival and correlated with distant metastasis in CRC patients, and the prognosis of CRC may be influenced by PCAT-1 expression, which suggested that PCAT-1 may be a potential diagnostic target in patients with colorectal cancer[2].

Regulation

PCAT-1 was regulated by PRC2 complex in prostate cancer cells[1].

Diseases

  • prostate cancer[1]
  • colorectal cancer[2]

Expression

PCAT-1, which is markedly overexpressed in a subset of prostate cancers, particularly metastases, and may contribute to cell proliferation in these tumors[1]

PCAT-1 was overexpressed in colorectal cancer[2].

Comparison of PCAT-1 expression levels between CRC tumor tissues and matched normal tissues by real time PCR analysis[2]

siRNA sequences (in sense format) were as follows:

PCAT-1 Sequence
siRNA 1 UUAAAGAGAUCCACAGUUAUU[1]
siRNA 2 GCAGAAACACCAAUGGAUAUU[1]
siRNA 3 AUACAUAAGACCAUGGAAAU[1]
siRNA 4 GAACCUAACUGGACUUUAAUU[1]
EZH2 Sequence
siRNA GAGGUUCAGACGAGCUGAUUU[1]


Labs working on this lncRNA

  • Michigan Center for Translational Pathology, University of Michigan Medical School, Ann Arbor, Michigan, USA[1].
  • State Key Laboratory of Oncology in South China, Sun Yat-Sen University Cancer Center, Guangzhou, China[2].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Prensner JR, Iyer MK, Balbin OA, Dhanasekaran SM, Cao Q, Brenner JC, et al. Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression[J]. Nature biotechnology. 2011,29(8):742-9.
  2. 2.0 2.1 2.2 2.3 2.4 Ge X, Chen Y, Liao X, Liu D, Li F, Ruan H, et al. Overexpression of long noncoding RNA PCAT-1 is a novel biomarker of poor prognosis in patients with colorectal cancer[J]. Medical oncology. 2013,30(2):588.

Basic Information

Transcript ID

ENST00000561978.1

Source

Gencode19

Same with

lnc-POU5F1B-2:2,NONHSAT129015,PCAT1,PCAT-1, PCA1

Classification

intergenic

Length

1992 nt

Genomic location

chr8+:128025399..128033259

Exon number

2

Exons

128025399..128026019,128031889..128033259

Genome context

Sequence
000001 ACACATGGAT ATTGGATATC TGCATAGGCA GCTTGCTCCA CGCCGGTGCC TACCTGTGCA GATGGGAAGG AAAGGAAAGT 000080
000081 GGCAAGGAGG CAGAGAAAGC ATCTGTACCC TTACAATTTG GTGAGACAAG AATGTATGAA TTCCCACAGG TCAAATTATA 000160
000161 ATGAAGAAAG GAACCTCTCT TGAGTACAAA GAGCTACCTA TGGTGGTCTG GAGCCGGAGG ACCACAGCAT CAAAGGATAT 000240
000241 AAGATGCATA GCCAACTGAG GAACCTGAGC AATTAAAGAG ATCCACAGTT AAGTCACACT TAACTGGCAC TTGTGGAAGC 000320
000321 CCCGCAAGGC CTGAAGGAGA GCTGACATAG GCACCCCAGA GAGCCAGAAT CTGGATCCCA TCTTAATAAG GCCATGAACA 000400
000401 CCAGTGGAGA AGAGGCAGAA ACACCAATGG ATAAGGAACA TTCACATCTT TCTTCCCATG TGCCTCTAAG TGCCAGTGCA 000480
000481 GGCCCCACAG GCCAAGCTAC AGGGAGAAAG GAGATGACGC AAAGGAACCT AACTGGACTT TAATCACTAG AAGTGAGAAG 000560
000561 AGAAATCTAT TGGAACCTCC CAAGATAATG CCAAGGGTCA AAGGGTGCGC AGATACATAA GACCATGGAA ATAATATCAG 000640
000641 ACAAAAAGCA GATTAGAGCA ATTTTCTTTT TCGAGTTCAA AATGGGTTAT AAAGCAGCGG AGACAAACCG CAACATCACC 000720
000721 AACGCCTTTG GCCCAGGAAC TGCTAATGAA GGTACAGTGC AGTCACTGTT CAGGAAGTTT TGCAAAGGAG ACTAGAGCCT 000800
000801 TGAAGATGAG GAGCATAGTG ACCAGCCATT GGAAGTCGAC AAAGACCAAT TGAGAGGAAT CATTGAAGCT GATCATCTTA 000880
000881 CAACTACACG AGAAGTTGTC AAAGAACGCA ATGTTGACCA TTGTGTGGTC TTTTCGCATT TGAAGCAAAT TGGAAAGGTG 000960
000961 AAAAACTTGA TAAGTGGGTG CCTTGTGAGC TCAGCAAAAA TCCAAAAAAA TAATCATTTT TAAGTGTTGT CTTCTCTTAT 001040
001041 TCTACGCAAC AACAATAACC ATTTTGCAAT CGGATTGTGA TGTGCAATGA AAAGTGGATT TGGGGCCGGG CGCGGTGGCT 001120
001121 CACGCCTGTA ATCTCAGCAC TTTGGAAGGC CAAGGCGGGC AGATCACGAG GTCAGGAGAT CAAGACCGTC CTGGCTAACA 001200
001201 CGGTGAAACC CCGTCTCTAC TGAAAATACA AAAAATTAGC CGGGTGTGGT GGCTGGCGCC TGTAGTCCCA GCTACAGGCT 001280
001281 GAGGCAGGAG AATGGCATGA ACCTGGGAGG CGGAGCTTGC AGTGAGCCGA GACCGTGCCA CTGCACTCCA GCCTGGGCGA 001360
001361 CAGAGCGATA CTCCGTCAAA AAAAAAAAAA AAAAAAAAAA AAGACAAGTG GATTTTATAT ATGGCAACCA GCAATGACCA 001440
001441 GCTCAGTGGC TGGACTGAGA AGAAGCTCCA AAGCACTTCC CAAAGCCAAA CTTGCACCAA AAAAAAGGTC AGGGTCACTG 001520
001521 TTTGGTGGTC TGCTGCTGGT CTGATCCACC GCTGCTCTCT GAATCCTGGC AAAACCATTA CATCTGAGAA GTATGCTCAA 001600
001601 CAAATCAATG AGCTACGCCA AAAACTGCAG CATCTGCAGC TGGCATTGGT CAACATAACG GGTCCAATTC TTCTCCACGA 001680
001681 CAACGCTCAA CTGCACCTTG CGCAAGCAGC GCTTCAAAAG TTGAACAAAT TGGGCTACAT AGTTTTTCCT CATCCGCCAT 001760
001761 ATTCACCTGA CGTCTTGCCA ACTAACTACC ACTTCTTCAA GTATCTCAAC AACTTTTTGC AGGGAAAACA CTTCCACAAC 001840
001841 CAGCAGGATG CAGAACACGC TTTCCAAGAG TTTGTCGAAT CCTGACGCAC AGATTTTTAT GCTACAGGAA TAAACTAACT 001920
001921 TATTTCTCAT TGGCAAAAAT GTGTTGATTG TAATGGTTCC TATTTTGATG AATAAATGTG TGTTTGAGCC TA
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox