ENST00000526269.2

From LncRNAWiki
Jump to: navigation, search

SENCR is a new vascular cell-enriched, cytoplasmic lncRNA that seems to stabilize the smooth muscle cell contractile phenotype.

Contents

Annotated Information

Name

SENCR: smooth muscle and endothelial cell enriched migration/differentiation-associated long non-coding RNA(HGNC nomenclature)

"FLI1 antisense RNA 1", "FLI1 antisense RNA 1 (non-protein coding)", FLI1-AS1[1]

Characteristics

SENCR spanning 1319 bp in 11q24 is transcribed antisense from the 5' end of the FLI1 gene and exists as 2 splice variants[1].

Cellular Localization

SENCR is a cytoplasmic lncRNA[1].

Function

SENCR acting as a fine-tuner of the vascular SMC phenotype[1].

Expression

Gene Primer Sequence(Forward) Primer Sequence(Reverse) Size(bp) Application(s)
SENCR_V2 GTAGAGTTTAAGCAGTGTGGAG GGTGGTGGAGTTGGAGTC 259 RT-PCR, fractionation[1]
SENCR_V2 TTACCTTGTCCACGCTCTCC CCGTCTCTCCGCATTCTCC 209 qPCR[1]
FLI1 TGTCTCTTTCGCTCCGCTAC CTCCTTAATAGTCCCGTCCATTTG 211 qPCR[1]
18S ATGGGCGGCGGAAAATAGC TCTTGGTGAGGTCAATGTCTGC 100 qPCR[1]
SENCR_V1/V2 GTGCGTAGAGTTTAAGCAGTGTGGAGAT AGGGCAAGTCTTCAATTTAATCTAGTTCCATATTG RT-PCR, cloning[1]
NEAT1 TTCCTTCTTCCCTTTAAGTTTCAC CTTACCATACAGAGCAACATACC 289 RT-PCR, fractionation[1]
XIST GAGATAGCTGCCTAGTGGAAATG CCTATCTGGGACCAGGAAAGTA 627 RT-PCR, fractionation[1]

Labs working on this lncRNA

  • Aab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, NY[1]

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Bell RD, Long X, Lin M, Bergmann JH, Nanda V, Cowan SL, et al. Identification and initial functional characterization of a human vascular cell-enriched long noncoding RNA[J]. Arteriosclerosis, thrombosis, and vascular biology. 2014,34(6):1249-59.

Basic Information

Transcript ID

ENST00000526269.2

Source

Gencode19

Same with

SENCR, FLI1-AS1

Classification

antisense

Length

1298 nt

Genomic location

chr11-:128561567..128565918

Exon number

3

Exons

128561567..128562016,128562550..128563286,128565808..128565918

Genome context

Sequence
000001 GTGCGTAGAG TTTAAGCAGT GTGGAGATAT TTCTTCACTT TTCCTTAGGG TGTCCACATC AAGACCCTGA GGCCATCTTA 000080
000081 CCACCCTTCT GGATCAGAAG AGGCCTTCAG AGCCCTCCGC TGCCGAGACG CGGCAGACTC CCAGAGCGGC TCACCCACTC 000160
000161 ATCGAAGCGG ATTCTGGGCG GTTTCGGGCT GACCCGCGCT GTCAGGGCGC GGACTCCATT CCGGGCGCAT TGTTAGGAGA 000240
000241 AGGGGCCCCT CGGGGCGGCG CGCCTCGACC CTGGGCTCCC GGTGCCCGCA GAGGGCGGAG ATCCGCGGCG CCCTAGGCCA 000320
000321 CCTATCCGCA TCTTCTCGAG CCAAACCCCC AGCGCTTACC CGGACCCGAC GGCCCAAGCA CTGACTCCCA GGCAAGAGTC 000400
000401 GCCCTTCCTG GTCCCCAGGG AACTGACACT ACCGCGGGAC GTTCCCTCTA GGACAGTCAG CAGGTCCCAG GAGCGCAGCA 000480
000481 CGCAACAGCG CAGAGCAGAC CCAGACTTTT CCCGGGGTGA GACCCGGAGG CCCGCGCTCT GGACCGTCCT CCCTACCCAG 000560
000561 CCTGGAGGCC GGCGTTCCCC GGCCCAACCC GGAGACCTCC CCGCCTCCCT CCTGGGCCGC CGCGCGCCCC AGTTGGAGCA 000640
000641 GCCTCGAGGG GCTGGGCCCT TTCGGCCGGA CTCCCTTCTC CCGGACATCC AAAACAGGTT ACCTTGTCCA CGCTCTCCGG 000720
000721 ACCACGCTTT GGACTTGCTC ACTTTTATTT AAGAGTCCGA CGGGGGAAAG AGGGAAAAAA AATCCAGAGG AGATCCAAGT 000800
000801 CAATTGGAAG AAAAAATTTC AAAAGGGTGT CCACAGAGGC GAAAAAAGCC CAGGCTCTAC CGACCTTCAA ACTACAACAG 000880
000881 AGCTTTCAGG AGAATGCGGA GAGACGGCTT CCCACCCGGA CCTCACCAGA AACCCGCACA CCCCAGCCAC ATTGCTCCTC 000960
000961 ATTCAGCCAG AAAGGACTCC AACTCCACCA CCAGGAGGCC CCCCTTCCTG GTGCTGGCCA GTTGCAGAGG CTGTTCATGG 001040
001041 CATCCCACAG GTGGCGACTG CCCCCCACCC TCCTCCTAGC ACTTTAGAGG GTCCCTCTGT GGCAGACACC ATGGCTAGGT 001120
001121 TTCTCTTTCC AACTCCTGTT GGTCTGGCAA GTGACAGATC ATCTTCACTA CATTAATCAG TAGTCACCCG AACATTCCTA 001200
001201 TACTGTCCCC CAATTCCTTT CAGCACCAGC TGCCTCCCCC ACTGGAATTA TTCAATATGG AACTAGATTA AATTGAAGAC 001280
001281 TTGCCCTTTA GTTTTTAA
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox