ENST00000502056.1

From LncRNAWiki
Jump to: navigation, search

CASC8: cancer susceptibility candidate 8,located in 8q24.21 region, is suggested to relate with cancer, such as colorectal cancer, prostate cancer, intestinal tumor,[1] and gastric cancer[2]

Contents

Annotated Information

Name

CASC8: cancer susceptibility candidate 8(non-protein coding)(HGNC nomenclature)

CARLo-1, LINC008600,"long intergenic non-protein coding RNA 860" [1]

Characteristics

CASC8, a long non-coding RNA, which overlapped POU5F1B gene,located in located in 8q24.21 region[2].

Function

CASC8 may presumably play a key role in modulating the recruitment of general transcription factors on the promoter of its cognate gene, POU5F1B, which was found to be a putative cancer susceptibility gene. It is biologically plausible that allele of rs10505477 further alters the fine turning interactions between the CASC8 and POU5F1B. [2].

Expression

LncRNA Experiment Probe/Primer
CARLo-1 v1&3 5′ RACE

5′ nested PCR and sequencing

Internal-F and sequencing

Internal-R and sequencing 3′ RACE 3′ nested PCR and sequencing

GGCAGGTTGTGTGTCACGCCCTCCACT

ATGTTTCATTGGCTGAAGCTCAATTG CCTCAGGAACACACATGGATGATTCT AAAGAGTATGGAGGCTTGAACATGGC AGTGGAGGGCGTGACACACAACCTGCC GCCATGTTCAAGCCTCCATACTCTTT[1]

CARLo-1 v2&4 5′ RACE

5′ nested PCR and sequencing Internal-F and sequencing Internal-R and sequencing 3′ RACE 3’nested PCR and sequencing

GCTCCTGGTCCATGCCATTCATCAATTG

GCTGAGGACAGAAGGCATTGGTCT GAGCATCCGAATAAATAAACATACAAATGC ATTTTTCACCTGCTTCAGTGCCATTGT GAGACCAATGCCTTCTGTCCTCAGC AATTGATGAATGGCATGGACCAGG[1]

CARLo-2 5′ RACE

5′ nested PCR and sequencing Internal-F and sequencing

Internal-R and sequencing

3′ RACE

3′ nested PCR and sequencing

CCTTGACTTGAGCCCAGGTCACCATGC

ACGTCTTCTCTTGGCTCCTCTGGAT AAACTATTGATGCAGTGTCCAAGGTGG ACATCAGTTAAAAGGCCAACAGGAACC GCATGGTGACCTGGGCTCAAGTCAAGG CTTATTTCTCTGCTGAACCATCACA[1]

CARLo-3 CARLo-3 TGGGCCTAGTACTTGGAGACGGGGACTG

TTGGATGATAGTGAAGGTGAACGTCTCT AACGAAGAGCATCACCATTTCCACCA ACTCTCCTAATGGGCCTAGTACTTGGAGAC AACGAAGAGCATCACCATTTCCACCACC AGAGACGTTCACCTTCACTATCATCCAA[1]

CARLo-4 5′ RACE

5′ nested PCR and sequencing Internal-F and sequencing

Internal-R and sequencing 3′ RACE

3′ nested PCR and sequencing

GTGACAGACGGAGTGCTGATGCCTCTGG

AATCTCTTCACATTGTGGAGTTTCTCCTC ATCTAGCAAATAGGCATCTGTCACAGAAAATAGA ATCAGCCTAACCAGCACGCATAAACTAAAC CCAGAGGCATCAGCACTCCGTCTGTCAC TCTGTCACTATTGGCATCCTGTGACA[1]

CARLo-5 5′ RACE

5′ nested PCR and sequencing Internal-F and sequencing Internal-R and sequencing 3′ RACE 3′ nested PCR and sequencing

GGGTTGAGAAGGGGTGAAGGGACACTGG

AAGTGAAGCTGGGAAGTTTGCACTTG GCCACAAATCAACAACAACAACAACAA AGAGTGATGCCAAGGCTGTTATTGTCAA CCAGTGTCCCTTCACCCCTTCTCAACCC[1]

CARLo-6 5′ RACE

5′ nested PCR and sequencing Internal-F and sequencing Internal-R and sequencing 3′ RACE 3′ nested PCR and sequencing

GGGTGCCATCACAGTCAGTTTGGACAGC

CTTGAATGCTATCAGGGAAGCTAGAGTG CTTAGAATTGGAGTGCCTGGGTTAGAA GCAGTCATTCAGGAATTGAAGCTGATA GCTGTCCAAACTGACTGTGATGGCACCC AGACAGACAGCGATGCCACATGTT[1]

Disease

Colorectal Cancer[1] Breast Cancer[1] Gastric Cancer[3]

Allelic Information and Variation

Please input allelic information and variation information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this lncRNA

  • Department of Molecular Virology, Immunology and Medical Genetics andDepartment of Anesthesiology, Wexner Medical Center, and Department of Neurological Surgery, The Ohio State University, Columbus, OH, 43210; [1].
  • Department of Environmental Genomics, Jiangsu Key Laboratory of Cancer Biomarkers, Prevention and Treatment, Cancer Center, Nanjing Medical University, Nanjing, China; Department of Genetic Toxicology, The Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing, China[2].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Kim T, Cui R, Jeon YJ, Lee JH, Lee JH, Sim H, et al. Long-range interaction and correlation between MYC enhancer and oncogenic long noncoding RNA CARLo-5[J]. Proceedings of the National Academy of Sciences of the United States of America. 2014,111(11):4173-8
  2. 2.0 2.1 2.2 2.3 Ma G, Gu D, Lv C, Chu H, Xu Z, Tong N, et al. Genetic variant in 8q24 is associated with prognosis for gastric cancer in a Chinese population[J]. Journal of gastroenterology and hepatology.
  3. Cite error: Invalid <ref> tag; no text was provided for refs named ref3

Basic Information

Transcript ID

ENST00000502056.1

Source

Gencode19

Same with

lnc-TMEM75-3:1,NONHSAT129035,CASC8

Classification

intergenic

Length

1412 nt

Genomic location

chr8-:128455595..128494384

Exon number

5

Exons

128455595..128455965,128491328..128491415,128491949..128492051,128492973..128493316,128493879..128494384

Genome context

Sequence
000001 TGAACCACCC CAGGCCCTTT GCACCTGCTA TTCCCTCTCC TCAGCATGCT CTGCCCCAGA CAATTGCAAT GCTAACTTCT 000080
000081 TACTTCCTTC AGGTTTCACT CAGAAATGAC TTTCTCAGTG GGGTCTCCCA TGACCATTTT ATTTAAGATT TCAACTACTT 000160
000161 TGCCAGTATT TCACTTCTCC TCCCTTGATC TTTTCTTCCA AGCACTCACT GCCCTCTTGC ACACTGTATC TTTTACTTAT 000240
000241 TTATCTTGTT CAGTTTCTGC CTGCCTCACC TGCCTCACCA CAGTGTACAT TTCACGAGGG CAGGGATTTT GTCTGTTTTG 000320
000321 TTGATTGCTG TAGCCCTGGC ATCTTGGGCA GTGCCAGCAC CTGTTAGCAT TAAATACATA TTTACTGAAT GAATGAGTGG 000400
000401 CTTCATGCTT AAAAGCAAGA AGAGAGACCT TCATAGAGAA GTAGGAAAAT GAATTGTTGC ACAAATAAAG GGCCATGTAA 000480
000481 TGAGAGAGAG AGAGCAAGAG AAAGAGCAAA CAATTAAGGA GCAGCAGTGG CTTCCTGCAG GGGAGACCAA TGCCTTCTGT 000560
000561 CCTCAGCGGA AACAGCTTGG CATTCTTCCA ATTGATGAAT GGCATGGACC AGGAGCACTA GTTATCTTCA GCTTCTGAGC 000640
000641 ATCCGAATAA ATAAACATAC AAATGCATAA CATAAAATAA ATTCAAATTA CAAATGAGAA AACCAATCTA GGTTACCGGC 000720
000721 AAGTCCTATG ACTTGATGTG GAGGCCTGGA AGTGCATCCT TGAATCTTGC AATGCAGTGA GCCAAGGAGC AATGAGAGGC 000800
000801 CACATGAATA ACCGGGCCAG TGACAAGACA CATGTCCTCC TCCTTGCTGG TATACACCAG AATGCCCCGC ATGCAGCGAA 000880
000881 TGCTCAAAAA GTGTTGGTGG AAGTGACAGA ATTCCATCAC CATTAAACAC AACCAGTGTT GCGGTTGACA ATGGCACTGA 000960
000961 AGCAGGTGAA AAATCCGTAC AGCAGCTTCT GTCTTTGAAG AGTTTGCAGC CTCTTGAAGA GGGTTTAGAG GTTAAAAAAA 001040
001041 GGACCCAGGC TGATAGGGCC GCTACCATTT GGAAAGTGAC AAGAGGAAGA GAGAGAATGA AACAACAGTA AGCACTGGCT 001120
001121 CTCAGCTTCT ACCTGAAGAG ACAAACATTG CTTTCACTTA CATTTCACTG GCCAAATCAA GCCCATGGCA ACAATTGAGT 001200
001201 TCAAAAGCAT AAGGAGGTAT CTGGAAGGAA GAGAATCAGA AAATTTCTGA TGAGCCTCAC TGACTACCTT CAGGGCAAAA 001280
001281 AGGAAGAGAG GCACTCCAGA TCAGAGATCT GCATTGGAAA CTCCTTGAGA ACCAGAAGGG TATGCTGTAT TTTTGTAACT 001360
001361 GTGAGGAGCC CAGAAAGACT GAAGCCCAAA TAAAATTCCT TTATTCAATA TT
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox