ENST00000412690.1

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "ENST00000412690.1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=ENST00000412690.1&oldid=1272286 (Last update: Jul 01, 2016). [See details]

LINC01191, a 869bp long non-coding RNA, which is induced by several IAV(influenza A virus) strains (H1N1, H3N2, H7N7) as well as vesicular stomatitis virus, functions in IAV propagation.

Contents

Annotated Information

Name

LINC01191: long intergenic non-protein coding RNA 1191(HGNC nomenclature)

lnc-ACTR3, VIN, "virus inducible lincRNA" [1]

Characteristics

In silico characterization of VIN[1]

LINC01191,virus inducible lincRNA (VIN), is induced by several IAV(influenza A virus) strains (H1N1, H3N2, H7N7) as well as vesicular stomatitis virus. [1]

Cellular Localization

VIN is localized to the host cell nucleus. [1]

Function

VIN expression was specifically induced upon infection with a number of IAV and VSV(vesicular stomatitis virus), suggesting that this lincRNA may have broader functionality during virus infection.

VIN adopts stable secondary structures, and thus, has a functional role in cells, perhaps in complex with other cellular components as it was largely insensitive to endonuclease.

Nuclear expression of VIN suggests an involvement in gene-regulatory processes and VIN is functionally relevant during pathogenesis of IAV infection which strengthens the view that lncRNAs are major players in diverse biological processes. [1]

Disease

VIN is functionally relevant during pathogenesis of IAV infection. [1]

Expression

VIN expression seems to be a specific response to certain viral infections including IAV and VSV, suggesting that this lincRNA may have broader functionality during virus infection. IBV, viral RNA mimics, or IFNβ are not able to induce VIN, this induction is likely to be a specific response and not due the presence of viral RNA itself.[1]

Experiment Primer Forward Reverse
qRT-PCR VIN CTAGGAGACACCCGGACAGT GCCCTGTGAGATGGGTTTAG[1]
Knockdown IAV Nucleoprotein AAGGAUCUUAUUUCUUCGGAG[1] _
VIN siRNA 1 CTGTGACATGTAGATTGCTAA[1] _
VIN siRNA 2 CCGGAGCCGTTTACAGTTTGA[1] _
VIN siRNA 3 CGCGCCCTGTCCCGCCATATA[1] _

Labs working on this lncRNA

  • Department of Molecular Biology; Max Planck Institute for Infection Biology; Berlin, Germany[1]

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Winterling C, Koch M, Koeppel M, Garcia-Alcalde F, Karlas A, Meyer TF. Evidence for a crucial role of a host non-coding RNA in influenza A virus replication[J]. RNA biology. 2014,11(1):66-75.

Basic Information

Transcript ID

ENST00000412690.1

Source

Gencode19

Same with

lnc-ACTR3-1:1,LINC01191,lnc-ACTR3, VIN

Classification

intergenic

Length

844 nt

Genomic location

chr2+:114737146..114764879

Exon number

2

Exons

114737146..114737705,114764596..114764879

Genome context

Sequence
000001 CCGGATTCCG AAGCCCGGAG CCGTTTACAG TTTGAGGCGC CGTGTGCCGC CCCCTGGTGG CCGGAGGCCG TTACTGTCGC 000080
000081 GGCTGAGGGG GCGTCCCGGT GTATCCGCAG CGCGCCCTGG CCGCCCTCTG GTGGCCGGAG GCCGTTACTG TCGCGGCTGA 000160
000161 GGGGGCGTCC CGGTGTATCC GCAGCGCGCC CTGGCCGCCC CCTGGTGGCC GGAGGCCGTT ACTGTCGCGG CTGAGGGGGC 000240
000241 GTCCCGGTGT ATCCGCAGCG CGCCCTGGCC GACCCCTGGT GGCCGGAGGC CGTTACTGTC GCGGCTGAAG GGGCGTGTCC 000320
000321 CGGTGTATCC GCAGCGCGCC CTGGCTGCCC CCTGGTGGCC GGAGGCCGTT ACTGTCGCGG CTGAGGGGGC GTCCCGGTGT 000400
000401 ATCCGCAGCG CGCCCTGTCC CGCCATATAC ATTCCGTGCT TTTCAAACAC CCGCCGTGGG CTAAGCATGG GACCCACGTG 000480
000481 GGGCGGGGAC ACACGGCGAT AAAGAGCCAG GCCCTCGCTG CCAAGGAGCT TTCCCGTAAC ACCGATGCAT CAAACAAAAG 000560
000561 GCAGCAGTGA GGATGCCAGA GTTCATGGGT TTCTAGAAGA CAAGTTTTCA ACTGCAGATA CAAACATCAG GACGTCAATG 000640
000641 TATCTGCTAG GAGACACCCG GACAGTGTTG AGAACACAGA ACCTGGAGGC TAAACCCCCA GCTTTCTATG CCAGCTGAGA 000720
000721 GTCTGTGGGC ACATTACTCA GCGTCTCTGA ACCTCATGCT CCTCCCCTGT GACATGTAGA TTGCTAAACC CATCTCACAG 000800
000801 GGCTATCTTC TGCATTTAAA GAATAAAATA ACACATGAGG GGTC
[back to top]
Please cite: Chunlei Yu (2016) lncRNA: "ENST00000412690.1" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=ENST00000412690.1&oldid=1272286 (Last update: Jul 01, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu2.358225390.9292016-07-01 16:54:25[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Guangyu Wang0.05115112016-06-30 17:10:43[show]
Lin Liu0.0011112016-06-30 13:54:06[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox