ENST00000412690.1

From LncRNAWiki
Jump to: navigation, search

LINC01191, a 869bp long non-coding RNA, which is induced by several IAV(influenza A virus) strains (H1N1, H3N2, H7N7) as well as vesicular stomatitis virus, functions in IAV propagation.

Contents

Annotated Information

Name

LINC01191: long intergenic non-protein coding RNA 1191(HGNC nomenclature)

lnc-ACTR3, VIN, "virus inducible lincRNA" [1]

Characteristics

In silico characterization of VIN[1]

LINC01191,virus inducible lincRNA (VIN), is induced by several IAV(influenza A virus) strains (H1N1, H3N2, H7N7) as well as vesicular stomatitis virus. [1]

Cellular Localization

VIN is localized to the host cell nucleus. [1]

Function

VIN expression was specifically induced upon infection with a number of IAV and VSV(vesicular stomatitis virus), suggesting that this lincRNA may have broader functionality during virus infection.

VIN adopts stable secondary structures, and thus, has a functional role in cells, perhaps in complex with other cellular components as it was largely insensitive to endonuclease.

Nuclear expression of VIN suggests an involvement in gene-regulatory processes and VIN is functionally relevant during pathogenesis of IAV infection which strengthens the view that lncRNAs are major players in diverse biological processes. [1]

Disease

VIN is functionally relevant during pathogenesis of IAV infection. [1]

Expression

VIN expression seems to be a specific response to certain viral infections including IAV and VSV, suggesting that this lincRNA may have broader functionality during virus infection. IBV, viral RNA mimics, or IFNβ are not able to induce VIN, this induction is likely to be a specific response and not due the presence of viral RNA itself.[1]

Experiment Primer Forward Reverse
qRT-PCR VIN CTAGGAGACACCCGGACAGT GCCCTGTGAGATGGGTTTAG[1]
Knockdown IAV Nucleoprotein AAGGAUCUUAUUUCUUCGGAG[1] _
VIN siRNA 1 CTGTGACATGTAGATTGCTAA[1] _
VIN siRNA 2 CCGGAGCCGTTTACAGTTTGA[1] _
VIN siRNA 3 CGCGCCCTGTCCCGCCATATA[1] _

Labs working on this lncRNA

  • Department of Molecular Biology; Max Planck Institute for Infection Biology; Berlin, Germany[1]

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Winterling C, Koch M, Koeppel M, Garcia-Alcalde F, Karlas A, Meyer TF. Evidence for a crucial role of a host non-coding RNA in influenza A virus replication[J]. RNA biology. 2014,11(1):66-75.

Basic Information

Transcript ID

ENST00000412690.1

Source

Gencode19

Same with

lnc-ACTR3-1:1,LINC01191,lnc-ACTR3, VIN

Classification

intergenic

Length

844 nt

Genomic location

chr2+:114737146..114764879

Exon number

2

Exons

114737146..114737705,114764596..114764879

Genome context

Sequence
000001 CCGGATTCCG AAGCCCGGAG CCGTTTACAG TTTGAGGCGC CGTGTGCCGC CCCCTGGTGG CCGGAGGCCG TTACTGTCGC 000080
000081 GGCTGAGGGG GCGTCCCGGT GTATCCGCAG CGCGCCCTGG CCGCCCTCTG GTGGCCGGAG GCCGTTACTG TCGCGGCTGA 000160
000161 GGGGGCGTCC CGGTGTATCC GCAGCGCGCC CTGGCCGCCC CCTGGTGGCC GGAGGCCGTT ACTGTCGCGG CTGAGGGGGC 000240
000241 GTCCCGGTGT ATCCGCAGCG CGCCCTGGCC GACCCCTGGT GGCCGGAGGC CGTTACTGTC GCGGCTGAAG GGGCGTGTCC 000320
000321 CGGTGTATCC GCAGCGCGCC CTGGCTGCCC CCTGGTGGCC GGAGGCCGTT ACTGTCGCGG CTGAGGGGGC GTCCCGGTGT 000400
000401 ATCCGCAGCG CGCCCTGTCC CGCCATATAC ATTCCGTGCT TTTCAAACAC CCGCCGTGGG CTAAGCATGG GACCCACGTG 000480
000481 GGGCGGGGAC ACACGGCGAT AAAGAGCCAG GCCCTCGCTG CCAAGGAGCT TTCCCGTAAC ACCGATGCAT CAAACAAAAG 000560
000561 GCAGCAGTGA GGATGCCAGA GTTCATGGGT TTCTAGAAGA CAAGTTTTCA ACTGCAGATA CAAACATCAG GACGTCAATG 000640
000641 TATCTGCTAG GAGACACCCG GACAGTGTTG AGAACACAGA ACCTGGAGGC TAAACCCCCA GCTTTCTATG CCAGCTGAGA 000720
000721 GTCTGTGGGC ACATTACTCA GCGTCTCTGA ACCTCATGCT CCTCCCCTGT GACATGTAGA TTGCTAAACC CATCTCACAG 000800
000801 GGCTATCTTC TGCATTTAAA GAATAAAATA ACACATGAGG GGTC
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox