ENST00000412654.1

From LncRNAWiki
Jump to: navigation, search

PCA3 is one of the most prostate-specific genes described to date, is highly overexpressed in PCa tumors, and has been extensively characterized as a tumor biomarker。

Contents

Annotated Information

Name

PCA3:prostate cancer associated 3 (non-protein coding)(HGNC nomenclature)

"non-protein coding RNA 19", PCAT3, "prostate cancer associated transcript 3 (non-protein coding)"[1]

DD3, NCRNA00019[2]

Charateristics

The noncoding RNA PCA3, which was initially characterized as Differential Display Code 3 (DD3), is prostate-tissue-specific and highly overexpressed in more than 95% of primary prostate cancers. PCA3 transcript has splicing and alternative polyadenylation, and a very short open reading frame[1].

Function

PCA3 whose expression at different PCa stages is involved in PCa survival pathways by controlling cell growth and viability, at least in part through controlling the AR pro-survival signaling[1].

Disease

  • prostate-cancer[1]

Expression

PCA3 is expressed in higher levels in the androgen-responsive cell line (LNCaP)[1].

Oligonucleotide primers used for analysis of RT-PCR and qRT-PCR expression of androgen receptor-responsive genes and PCA3 transcript are as follows,

Gene Primer Forward 5'-3' Primer Reverse 5'-3'
PMEPA1 CATGATCCCCGAGCTGCT TGATCTGAACAAACTCCAGCTCC[1]
18S AACCCGTTGAACCCCATT CGCTACTACCGATTGGATGG[1]
GAPDH TGACCCCTTCATTGACCTCA AGTCCTTCCACGATACCAAA[1]
TMPRSS2 CTGGTGGCTGATAGGGGATA GGACAAGGGGTTAGGGAGAG[1]
NDRG1 CGAGACTTTACATGGCTCTG GCATTGATGAACAGGTGCAG[1]
GREB1 AAGGAGGGCTGGAAACAAAT CATTGTGGCCATTGTCATCT[1]
PCA3 : 69-F AGATTTGTGTGGCTGCAGC[1]
PCA3 : 510-R TCCTGCCCATCCTTTAAGG[1]

Labs working on this lncRNA

Instituto Nacional do Câncer/Programa de Carcinogênese Molecular and Programa de Pós Graduação Stricto Sensu em Oncologia, Rio de Janeiro, Brazil[1].

Urology Research Laboratory, University Hospital Nijmegen, The Netherlands[2].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Ferreira LB, Palumbo A, de Mello KD, Sternberg C, Caetano MS, de Oliveira FL, et al. PCA3 noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen receptor signaling[J]. BMC cancer. 2012,12:507.
  2. 2.0 2.1 Bussemakers MJ, van Bokhoven A, Verhaegh GW, Smit FP, Karthaus HF, Schalken JA, et al. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer[J]. Cancer research. 1999,59(23):5975-9.

Basic Information

Transcript ID

ENST00000412654.1

Source

Gencode19

Same with

lnc-FOXB2-1:1, PCA3, DD3, PCAT3

Classification

intergenic

Length

3922 nt

Genomic location

chr9+:79379352..79402485

Exon number

4

Exons

79379352..79379471,79397584..79397748,79398621..79398803,79399032..79402485

Genome context

Sequence
000001 ACAGAAGAAA TAGCAAGTGC CGAGAAGCTG GCATCAGAAA AACAGAGGGG AGATTTGTGT GGCTGCAGCC GAGGGAGACC 000080
000081 AGGAAGATCT GCATGGTGGG AAGGACCTGA TGATACAGAG GAATTACAAC ACATATACTT AGTGTTTCAA TGAACACCAA 000160
000161 GATAAATAAG TGAAGAGCTA GTCCGCTGTG AGTCTCCTCA GTGACACAGG GCTGGATCAC CATCGACGGC ACTTTCTGAG 000240
000241 TACTCAGTGC AGCAAAGAAA GACTACAGAC ATCTCAATGG CAGGGGTGAG AAATAAGAAA GGCTGCTGAC TTTACCATCT 000320
000321 GAGGCCACAC ATCTGCTGAA ATGGAGATAA TTAACATCAC TAGAAACAGC AAGATGACAA TATAATGTCT AAGTAGTGAC 000400
000401 ATGTTTTTGC ACATTTCCAG CCCCTTTAAA TATCCACACA CACAGGAAGC ACAAAAGGAA GCACAGAGAT CCCTGGGAGA 000480
000481 AATGCCCGGC CGCCATCTTG GGTCATCGAT GAGCCTCGCC CTGTGCCTGG TCCCGCTTGT GAGGGAAGGA CATTAGAAAA 000560
000561 TGAATTGATG TGTTCCTTAA AGGATGGGCA GGAAAACAGA TCCTGTTGTG GATATTTATT TGAACGGGAT TACAGATTTG 000640
000641 AAATGAAGTC ACAAAGTGAG CATTACCAAT GAGAGGAAAA CAGACGAGAA AATCTTGATG GCTTCACAAG ACATGCAACA 000720
000721 AACAAAATGG AATACTGTGA TGACATGAGG CAGCCAAGCT GGGGAGGAGA TAACCACGGG GCAGAGGGTC AGGATTCTGG 000800
000801 CCCTGCTGCC TAAACTGTGC GTTCATAACC AAATCATTTC ATATTTCTAA CCCTCAAAAC AAAGCTGTTG TAATATCTGA 000880
000881 TCTCTACGGT TCCTTCTGGG CCCAACATTC TCCATATATC CAGCCACACT CATTTTTAAT ATTTAGTTCC CAGATCTGTA 000960
000961 CTGTGACCTT TCTACACTGT AGAATAACAT TACTCATTTT GTTCAAAGAC CCTTCGTGTT GCTGCCTAAT ATGTAGCTGA 001040
001041 CTGTTTTTCC TAAGGAGTGT TCTGGCCCAG GGGATCTGTG AACAGGCTGG GAAGCATCTC AAGATCTTTC CAGGGTTATA 001120
001121 CTTACTAGCA CACAGCATGA TCATTACGGA GTGAATTATC TAATCAACAT CATCCTCAGT GTCTTTGCCC ATACTGAAAT 001200
001201 TCATTTCCCA CTTTTGTGCC CATTCTCAAG ACCTCAAAAT GTCATTCCAT TAATATCACA GGATTAACTT TTTTTTTTAA 001280
001281 CCTGGAAGAA TTCAATGTTA CATGCAGCTA TGGGAATTTA ATTACATATT TTGTTTTCCA GTGCAAAGAT GACTAAGTCC 001360
001361 TTTATCCCTC CCCTTTGTTT GATTTTTTTT CCAGTATAAA GTTAAAATGC TTAGCCTTGT ACTGAGGCTG TATACAGCCA 001440
001441 CAGCCTCTCC CCATCCCTCC AGCCTTATCT GTCATCACCA TCAACCCCTC CCATGCACCT AAACAAAATC TAACTTGTAA 001520
001521 TTCCTTGAAC ATGTCAGGCA TACATTATTC CTTCTGCCTG AGAAGCTCTT CCTTGTCTCT TAAATCTAGA ATGATGTAAA 001600
001601 GTTTTGAATA AGTTGACTAT CTTACTTCAT GCAAAGAAGG GACACATATG AGATTCATCA TCACATGAGA CAGCAAATAC 001680
001681 TAAAAGTGTA ATTTGATTAT AAGAGTTTAG ATAAATATAT GAAATGCAAG AGCCACAGAG GGAATGTTTA TGGGGCACGT 001760
001761 TTGTAAGCCT GGGATGTGAA GCAAAGGCAG GGAACCTCAT AGTATCTTAT ATAATATACT TCATTTCTCT ATCTCTATCA 001840
001841 CAATATCCAA CAAGCTTTTC ACAGAATTCA TGCAGTGCAA ATCCCCAAAG GTAACCTTTA TCCATTTCAT GGTGAGTGCG 001920
001921 CTTTAGAATT TTGGCAAATC ATACTGGTCA CTTATCTCAA CTTTGAGATG TGTTTGTCCT TGTAGTTAAT TGAAAGAAAT 002000
002001 AGGGCACTCT TGTGAGCCAC TTTAGGGTTC ACTCCTGGCA ATAAAGAATT TACAAAGAGC TACTCAGGAC CAGTTGTTAA 002080
002081 GAGCTCTGTG TGTGTGTGTG TGTGTGTGAG TGTACATGCC AAAGTGTGCC TCTCTCTCTT TGACCCATTA TTTCAGACTT 002160
002161 AAAAACAAGC ATGTTTTCAA ATGGCACTAT GAGCTGCCAA TGATGTATCA CCACCATATC TCATTATTCT CCAGTAAATG 002240
002241 TGATAATAAT GTCATCTGTT AACATAAAAA AAGTTTGACT TCACAAAAGC AGCTGGAAAT GGACAACCAC AATATGCATA 002320
002321 AATCTAACTC CTACCATCAG CTACACACTG CTTGACATAT ATTGTTAGAA GCACCTCGCA TTTGTGGGTT CTCTTAAGCA 002400
002401 AAATACTTGC ATTAGGTCTC AGCTGGGGCT GTGCATCAGG CGGTTTGAGA AATATTCAAT TCTCAGCAGA AGCCAGAATT 002480
002481 TGAATTCCCT CATCTTTTAG GAATCATTTA CCAGGTTTGG AGAGGATTCA GACAGCTCAG GTGCTTTCAC TAATGTCTCT 002560
002561 GAACTTCTGT CCCTCTTTGT GTTCATGGAT AGTCCAATAA ATAATGTTAT CTTTGAACTG ATGCTCATAG GAGAGAATAT 002640
002641 AAGAACTCTG AGTGATATCA ACATTAGGGA TTCAAAGAAA TATTAGATTT AAGCTCACAC TGGTCAAAAG GAACCAAGAT 002720
002721 ACAAAGAACT CTGAGCTGTC ATCGTCCCCA TCTCTGTGAG CCACAACCAA CAGCAGGACC CAACGCATGT CTGAGATCCT 002800
002801 TAAATCAAGG AAACCAGTGT CATGAGTTGA ATTCTCCTAT TATGGATGCT AGCTTCTGGC CATCTCTGGC TCTCCTCTTG 002880
002881 ACACATATTA GCTTCTAGCC TTTGCTTCCA CGACTTTTAT CTTTTCTCCA ACACATCGCT TACCAATCCT CTCTCTGCTC 002960
002961 TGTTGCTTTG GACTTCCCCA CAAGAATTTC AACGACTCTC AAGTCTTTTC TTCCATCCCC ACCACTAACC TGAATGCCTA 003040
003041 GACCCTTATT TTTATTAATT TCCAATAGAT GCTGCCTATG GGCTATATTG CTTTAGATGA ACATTAGATA TTTAAAGCTC 003120
003121 AAGAGGTTCA AAATCCAACT CATTATCTTC TCTTTCTTTC ACCTCCCTGC TCCTCTCCCT ATATTACTGA TTGCACTGAA 003200
003201 CAGCATGGTC CCCAATGTAG CCATGCAAAT GAGAAACCCA GTGGCTCCTT GTGGTACATG CATGCAAGAC TGCTGAAGCC 003280
003281 AGAAGGATGA CTGATTACGC CTCATGGGTG GAGGGGACCA CTCCTGGGCC TTCGTGATTG TCAGGAGCAA GACCTGAGAT 003360
003361 GCTCCCTGCC TTCAGTGTCC TCTGCATCTC CCCTTTCTAA TGAAGATCCA TAGAATTTGC TACATTTGAG AATTCCAATT 003440
003441 AGGAACTCAC ATGTTTTATC TGCCCTATCA ATTTTTTAAA CTTGCTGAAA ATTAAGTTTT TTCAAAATCT GTCCTTGTAA 003520
003521 ATTACTTTTT CTTACAGTGT CTTGGCATAC TATATCAACT TTGATTCTTT GTTACAACTT TTCTTACTCT TTTATCACCA 003600
003601 AAGTGGCTTT TATTCTCTTT ATTATTATTA TTTTCTTTTA CTACTATATT ACGTTGTTAT TATTTTGTTC TCTATAGTAT 003680
003681 CAATTTATTT GATTTAGTTT CAATTTATTT TTATTGCTGA CTTTTAAAAT AAGTGATTCG GGGGGTGGGA GAACAGGGGA 003760
003761 GGGAGAGCAT TAGGACAAAT ACCTAATGCA TGTGGGACTT AAAACCTAGA TGATGGGTTG ATAGGTGCAG CAAACCACTA 003840
003841 TGGCACACGT ATACCTGTGT AACAAACCTA CACATTCTGC ACATGTATCC CAGAACGTAA AGTAAAATTT AAAAAAAAGT 003920
003921 GA
[back to top]
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox