DALIR

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2016) lncRNA: "DALIR" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=DALIR&oldid=1272415 (Last update: Aug 22, 2016). [See details]

DNMT1-associated long intergenic non-coding RNA, acts both locally to regulate the expression of its nearest protein-coding gene, Pou3f3, and distally to regulate both Pou3f3-dependent and -independent target genes in an RNA-dependent manner.

Contents

Annotated Information

Name

DALIR :DNMT1-associated long intergenic non-coding RNA (HGNC nomenclature)

DALI[1]

Characteristics

Dali transcribed downstream of the Pou3f3 transcription factor gene is a conserved central nervous system expressed intergenic lncRNA[1].

Function

Dali regulates transcription in both Pou3f3-dependent and -independent manners[1].
Dali plays a role in regulating genes in neuronal cells[1].

The intergenic lncRNA Dali acts both locally to regulate the expression of its nearest protein-coding gene, Pou3f3, and distally to regulate both Pou3f3-dependent and -independent target genes in an RNA-dependent manner.[1]

Dali interacts with the DNMT1 DNA methyltransferase in mouse and human and regulates DNA methylation status of CpG island-associated promoters in trans, which demonstrates that a single intergenic lncRNA controls the activity and methylation of genomically distal regulatory elements to modulate large-scale transcriptional programmes.[1]

Dali may be involved in regulating nuclear function during neuronal development, potentially in coordination with Pou3f3. Dali regulates genes involved in neural development and function and its depletion disrupts terminal stages of neuronal differentiation, more particularly neurite outgrowth development.[1] .

Expression

Dali qPCR
linc8 for1821 CCTCCGATCCTGCAGTTAGC[1]
linc8 rev1912 ACAGCAGTTCAGCAGCAAGAAG[1]

Sequence

>gi|755571614|ref|NR_130904.1| Mus musculus DNMT1 associated long intergenic non-coding RNA (Dalir), long non-coding RNA

000001 TTTGTTTTTT AAATCAAGAT TATAGATTTT GGGGAGGTGA CTCAGGAGTT AAGAGCATTT GCAACTCTCC AAGGAGGCTT 000080
000081 GGATTCAGTT CCTAGTACCC ACATGGTGGC TCACAATCAT CTATAACTTG AGTTTCAGGA AATCCAATAC TCTCTTCTGA 000160
000161 CCTCTACATA AACCAGGCAT GCACATGATG CACATAAATA TTGTGCAGGC AAACACCGTC CCCCAGACAC TCAAAATACA 000240
000241 TAAAATAAAA ATAAGTATTT TTTAAAAGTT GGAATTTGGT ATGATTAGCT TTATAGCTTT AGCTATTTAT ATTAGTTTTA 000320
000321 TGGCAACTTG ACACTACCCA GAGTCATTTT GGAAGAGGGA ACCTCAGTTG AGAAAAATCC TCCACCATAT TGATCTATGA 000400
000401 GCAAGCCAGT AAGCAGCACT CCTTCATGGC CTCTGCATCA GCTCCTGCTT CCAGGTTCCT GCCCTGGTTG AGTTCCTGCC 000480
000481 TTGACTTTCC CTCAGTGATA GAGTGTTCTT GGGAGTGTAG ATGAAGTAAA CCCTCGCCTC CTAAACTGCC CTTGGTCATG 000560
000561 ATCTTTTATC ATAGCAATGG AACCCCTACT TAAGACAATT ATCTTTGAAG CACATATTTT GACATTTAGG CATATCAATA 000640
000641 AATGATTGAT GGTTAGTTTC TTAAAATGCC CCTTGACCAC AAAGACAGTG AATTTTCTCC CTTGCTCCCT AGCATAGATT 000720
000721 ATAGGTCTGA GCCATCAGAT CTGGCTTGAG GTTCAAAGCT TGTGACCACC TGTTCCAAGG ACAAATGAGC TGCCTAGAAC 000800
000801 TCTTCCACTG GCCTGCCTGT AGCCGGGAAT GGTGGAGTTC CCTGTGACTG TGGGATTCTA TATGAGCTAC TGATGAGACA 000880
000881 TAAGCAAGTA AGGAAAGTTG ATCTTGGGAT CAACACTCAT CAAGAATAAG ATGGGTCCCC CACTCTCTAG CTGTGCTTCC 000960
000961 AGACAGGTTT GCTTCAGTGT GGCTTCAGCA AAGCCTTCCT AGTGGTCTAC AGTAGAGAAT GCAAGAGTCC ATCCCTAGCC 001040
001041 TGAACACTGC ACACAGACAC CAATTATGCT AAAATATTTA ATTTCATTCC ATAAATAATT AAGCCTAAAT AATAATACCT 001120
001121 AGATATAACT TGGAACTTGT GACAATCTAC CTGCCTCTGT CTCTGTGTAC CAGGATTATA GGCCTGGGCA CACATTCTTC 001200
001201 TTCAGGACTG ATTATAATAC ATTTTGTATA TTGATTTAAA AAAATGATGC TTAGGTAGTT ATGGCCTGTG AGTAATTCTA 001280
001281 TAAAGTAGAC TAAGTGGATA TCATCAGTCT ATACTCTAAG ACATTCCTTT AATTTTTTTA AATTTTTTTT TAAAGTTCTA 001360
001361 CTTTTTAAAG ATTCCTAGAG AGCCAGATGG GTGATGAAAA GCCAGGTTTC ACATGTAACA CTAATATTGG GGGAAAAAAA 001440
001441 ACCTGACGCT AGAAATTATT TAGTTATTCT GAAAGCTGTC ACTTCTTGAA AGCAGAGTCA GAATTAGAAA AGAATTAACA 001520
001521 GTGTATCGTT GTGTTCTCAC ATTTCCAATG TGGCTGGTGA ATCATGAAGC AAAAATTTCC TCAAAACTGG AGCCCCAGAG 001600
001601 TCTTAGTCTG AGCCCATCCT CCTGCCTGAG AATCTCCAAA TTGCCTAGTG AAGGAAAAGC TATGTCCATG GTCCCACCTG 001680
001681 TTCCAAAGTC CCTTTGGAAA TCTAGGCAGA AGTAGGTTTG CTAGAGTCTT ACTTATGACA ACCTGGGAAA CAAAGAAGGC 001760
001761 TCTTCATACA AGGGTGTGTA TCCACACAAG AGGCAGCATC CTGAAGGAAA CCTTCAGGAG CCTCCGATCC TGCAGTTAGC 001840
001841 TGACTGTTTC CTGCCCTCCT TGGTCCAACT CGTTATGGCC CCAGGTGTTC CTTCTTGCTG CTGAACTGCT GTCTCTACCA 001920
001921 GCTGAGCCCA CTCCTGTGGT CTGCACTCAC TGCCCTGGCT GCAGGTTGAA CAGGGTCAGG CTACTTCTCA GATGCTTCCC 002000
002001 ACCAGCCGCA GTGAACTCCA TTTTGACATG AAGCCATTTA AATGGAAATC CAGTTTTACA AAGCTCAAGT GACTGGTAAT 002080
002081 GAAGATGTGA ATGATGCTTA TGAGGTTTTT ATTTAATTTT AAATCAATTG TGTATTCTAA TTCATTAATA AAGGGGAAAG 002160
002161 GAAAGAATAC AGGAAAAAAA AAAAAAAAAA

Labs working on this lncRNA

  • University of Oxford, United Kingdom[1].

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Chalei V, Sansom SN, Kong L, Lee S, Montiel JF, Vance KW, et al. The long non-coding RNA Dali is an epigenetic regulator of neural differentiation[J]. eLife. 2014,3:e04530.
Please cite: Chunlei Yu (2016) lncRNA: "DALIR" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=DALIR&oldid=1272415 (Last update: Aug 22, 2016).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu4.814148660.9892015-04-09 17:39:24[show]
Contributors with score < 1 are excluded from the authorship.
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Lin Liu0.02612612016-08-22 15:02:09[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox