CCAT2

From LncRNAWiki
Jump to: navigation, search
Please cite: Chunlei Yu (2015) lncRNA: "CCAT2" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=CCAT2&oldid=1270652 (Last update: Apr 09, 2015). [See details]

CCAT2, a novel long noncoding RNA transcript (lncRNA) harboring a single nucleotide polymorphism rs6983267 SNP, promotes tumor growth, metastasis, and chromosomal instability, including colon cancer[1] and non-small cell lung cancer [2]

Contents

Annotated Information

Name

CCAT2, colon cancer-associated transcript 2 (CCAT2) (HGNC nomenclature) LINC00873, "long intergenic non-protein coding RNA 873", NCCP1, "non-coding RNA involved in cancer predisposition 1"[1].

Characteristics

CCAT2 is transcribed from chromosome 8q24 which is a very conserved region harboring a single nucleotide polymorphism rs6983267 [2].

Function

A model of CCAT2 locus involvement in CRC [1].

CCAT2 which responds to WNT signaling can regulates MYC transcription and promotes cancer growth and metastasis and induces chromosomal instability [1].

CCAT2 is a lung adenocarcinoma-specific lncRNA and promotes invasion of NSCLC and highlight its potential as a biomarker for lymph node metastasis [2].

Regulation

rs6983267 status affects the CCAT2 expression, providing an additional mechanism linking the risk allele of rs6983267 with higher CRC risk. [1]

Diseases

  • colon cancer[1] non-small cell lung cancer[2]

Expression

CCAT2 is expressed at high levels in MSS CRC tumor tissues and influences MYC levels, but has very low-level expression in normal colon tissues. [1]

PCR Primers Sequence
CCAT2 F1 CCCTGGTCAAATTGCTTAACCT[1]
CCAT2 R1 TTATTCGTCCCTCTGTTTTATGGAT[1]
CCAT2 F2 CCGAGGTGATCAGGTGGACTTTC[1]
CCAT2 R2 GTCTTCTGGGCTGATGTTGC[1]
siRNA Target Sequence
CCAT2 siRNA 1 TTAACCTCTTCCTATCTCA[1]
CCAT2 siRNA 2 AGGTGTAGCCAGAGTTAAT[1]
CCAT2 siRNA 3 CGAATAAACTCTCCTCCTA[1]
shRNA Sequences cloned into pRS vector
CCAT2 shRNA1 GATCCCCAATTGCTTAACCTCTTCCTTTCAAGAGAAGGAAGAGGTTAAGCAATTTTTTTA[1]
CCAT2 shRNA2 GATCCCCGATGAAAGGCACTGAGAAATTCAAGAGATTTCTCAGTGCCTTTCATCTTTTTA[1]
CCAT2 shRNA3 GATCCCCTTAACCTCTTCCTATCTCATTCAAGAGATGAGATAGGAAGAGGTTAATTTTTA[1]

Sequence

>gi|565671809|ref|NR_109834.1| Homo sapiens colon cancer associated transcript 2 (non-protein coding) (CCAT2), long non-coding RNA

000001 CCGAGGTGAT CAGGTGGACT TTCCTGGATG TTCTGGGTCT TGACCTGATT GCTGAAAAAT GAATACAAAT TCAGAGAAGA 000080
000081 AGAAAGCTAG TATGAGACTA CCAAATGATC ATCAGACATT TCTTGAACAC CAATTAAATT GCTAGGTATG CTAAAGTTTG 000160
000161 CAAAACTGGT ATAGACACCA AGAGGGAGGT ATCAACAGAG ACTCCCCAAG AGCTAAGAGG AAACCACCTT GGACTGGAAG 000240
000241 TCAAGAGCCA AAATTCTAGA CTCTACTCTG TAATTAACTA CCTATTTGAA TTTGGAAAAA TCACCATCAA CTTTCCCAGC 000320
000321 CTCGTTCTCT GCATCTGGGA AATGAAGGCG TCGTCCAAAT GATTACAAGC TTCTTTTCCT GCTCTTATTG CATGATTCCA 000400
000401 CTTCCACAGC CCTCCAGCAT TTTTTAGCAG CTGCATCGCT CCATAGAGCC TGCAGAGGGC ACTAGACTGG GAATTAGAAA 000480
000481 ACCTGATTTC CCTTCCAGCT CCACCTCTGA CCAATTGCCT GACCCTGGTC AAATTGCTTA ACCTCTTCCT ATCTCAGCTC 000560
000561 CCTATCCATA AAACAGAGGG ACGAATAAAC TCTCCTCCTA CCACTAAGAG GTGTAGCCAG AGTTAATACC CTCATCGTCC 000640
000641 TTTGAGCTCA GCAGATGAAA GGCACTGAGA AAAGTACAAA GAATTTTTAT GTGCTATTGA CTTTATTTTA TTTTATGTGG 000720
000721 GGGAGGGAGC CGGCCCCAGC TGGAAAGCTG CTTTCTCTGA ATCAAAGGGC AGGAACCCAG CAAGTTTCTC AGGATTGGGG 000800
000801 CCTTAGACTG GGCTGTGTAT ACAGACAGTG CCAGCCAACC CCACAGTTCA GTTTCCTTTA ACCTGGTGCT CCAGGCAATA 000880
000881 ACTGTGCAAC TCTGCAATTT AACAATGTGT TCTTTGTCCC ACAACTGTTC TCGTTTCTCA ACTGCCCAGG TAATATGTTT 000960
000961 GGGCCTGTAG GAAGAGTCAA ATAGTTAATA AGGGAAGGGT TTGGCATGCC CTACGTAAGT TCTACCAGCA AGTCCCAACA 001040
001041 AGAAGGCATT CTGTGTCTCC TGATTCCTGA CCTACCCCCA AAATGTACAA ATGTACAAGG AATGAGCCCA CTTTCCCAGC 001120
001121 AGGCTGTAAT ACCAGTTTGG CCTATATCAA TGCATTGGTG AGCTGTGTTT TGTTTATGGT TTTATGCCAT CTATTTTCCC 001200
001201 ATGGATATTA TGTTTTCTAA AGAGCCCTTA AGTTTACGTC AGCTTTTAAA GCTACCAGCA GCACCATTTC AGTTCATATT 001280
001281 AAGCCCTTAA TATGGTATGA ATAGGAGAGC TATTAGACTA AAGAGCCATA ATCATCCCTG AGGAAAACAT CCATCACCAA 001360
001361 CATTTATGTG GTCCCTGAAC TTCTAAAAGG TGTCATCTCT CTGGGGTGTA TCTGGTGAGA GCTTTCTCTG GGAGATGCCA 001440
001441 AAAAGCCAAT GCATTAGATG AAGCTTAGAA GGGCATTTTC TAACCATTAC AAATTGCCTA GTCTAGCATC TCAATTTCAT 001520
001521 CTACGTGAAG AGCCTTAATT AAATTTGTTG GGGTTTGATC CTTTATCCCC AGATGTGGCG CTGACAGAGA TTGCTTACAT 001600
001601 AAATAATGTG TGCTCCAAGT GCTTGCCAGG CTCCTGGCTC AGCTGGGACA GCTGTAGCTT TTTGAATGTC ATTCCCAAGA 001680
001681 TATCCTGCAG GTGTTCAGCT TCCCCTGTTC TACTCTGGGA AGAGAGCCGT GGGCAACATC AGCCCAGAAG AC

Labs working on this lncRNA

  • Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas 77030, USA; [1]
  • Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing Medical University Affiliated Cancer Hospital, Cancer Institute of Jiangsu Province, Nanjing, 210009, China [2].

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Ling H, Spizzo R, Atlasi Y, Nicoloso M, Shimizu M, Redis RS, et al. CCAT2, a novel noncoding RNA mapping to 8q24, underlies metastatic progression and chromosomal instability in colon cancer[J]. Genome research. 2013,23(9):1446-61.
  2. 2.0 2.1 2.2 2.3 2.4 Qiu M, Xu Y, Yang X, Wang J, Hu J, Xu L, et al. CCAT2 is a lung adenocarcinoma-specific long non-coding RNA and promotes invasion of non-small cell lung cancer[J]. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2014,35(6):5375-80.
Please cite: Chunlei Yu (2015) lncRNA: "CCAT2" in LncRNAWiki, available at http://lncrna.big.ac.cn/index.php?title=CCAT2&oldid=1270652 (Last update: Apr 09, 2015).
ContributorContribution Score*Edit Count#Summed Edit QuantityΛAveraged Edit QualityLatest Edit TimeEdit Details
Chunlei Yu5.6391563912015-04-09 15:54:58[show]
Note: For each edit version that is contributed by a specific person, his/her contribution is quantified as its edit quality multiplied by its edit quantity; the edit quantity amounts to the edit distance in comparsion with its previous version (that is, the minimum number of edit operations required to transform one string into the other), and the edit quality corresponds to whether the edit persists in comparison with the last version, ranging from -1, when the edit is entirely reverted (short-lived), to 1, indicating that the edit is totally preserved in the last version (long-lived). Please also note that contribution quantification may take time to reflect recent edits.
*Since one person may perform many discontinuous edits for a wiki page, contribution score is the sum of quantified contributions over all participated edits.
#Multiple successive edits provided by a researcher are counted as one edit.
ΛSummed edit quantity is the sum of edit quantities over all participated edits.
Averaged edit quality is the edit quality normalized over all participated edits.
Personal tools
Namespaces

Variants
Actions
Navigation
About
ScienceWikis
Toolbox